ID: 1128391976

View in Genome Browser
Species Human (GRCh38)
Location 15:67188461-67188483
Sequence CAGGTAGACCTGACTATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128391976_1128391982 16 Left 1128391976 15:67188461-67188483 CCTGATATAGTCAGGTCTACCTG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1128391982 15:67188500-67188522 CTCTCAGGCCATCCTGCTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 173
1128391976_1128391980 1 Left 1128391976 15:67188461-67188483 CCTGATATAGTCAGGTCTACCTG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1128391980 15:67188485-67188507 TCTGCTTGGTTGAATCTCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 150
1128391976_1128391981 15 Left 1128391976 15:67188461-67188483 CCTGATATAGTCAGGTCTACCTG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1128391981 15:67188499-67188521 TCTCTCAGGCCATCCTGCTTTGG 0: 1
1: 0
2: 2
3: 18
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128391976 Original CRISPR CAGGTAGACCTGACTATATC AGG (reversed) Intronic
901144812 1:7057701-7057723 CAGTTAGTCCTGACAACATCTGG + Intronic
901799334 1:11698392-11698414 CAGGAAGCCCTAACTAGATCTGG + Intronic
906179700 1:43807628-43807650 CAGGGAGACCTGGCTATAACAGG + Intronic
911248680 1:95549588-95549610 CAGGTAGTCTTGACCATATTAGG + Intergenic
912345185 1:108957167-108957189 TAGGTAGACCCTACTACATCTGG + Intronic
916756786 1:167778379-167778401 CAGGTACACACCACTATATCTGG - Intronic
917677077 1:177329846-177329868 TGGGTAGACCTGACTCAATCAGG + Intergenic
922849988 1:228724323-228724345 CAGTTATACCTGAATAAATCTGG - Intergenic
922875843 1:228939337-228939359 CAGGTGGACCAGGCTATAACTGG - Intergenic
923162333 1:231325775-231325797 CAGGTAGAACTGAGTAGATGGGG - Intergenic
1063144384 10:3283590-3283612 CAGGTACACATCACCATATCTGG + Intergenic
1064532783 10:16327123-16327145 CTGGAAGAACTGACTAGATCAGG + Intergenic
1080461058 11:32455324-32455346 CTGGAAGACCTGACTTTATCTGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1086950839 11:92888799-92888821 GAGGAAGACCTCACTATTTCCGG - Intronic
1087301944 11:96446331-96446353 CAGTTGGACCTGACTTCATCAGG - Intronic
1087779029 11:102283828-102283850 CAGGTAGACGTGACTTTCTGTGG + Intergenic
1089339634 11:117748753-117748775 CAGGGAGACCTGACCATCTAGGG + Intronic
1090074486 11:123571449-123571471 CAGCTAGACCTAACTATAGGAGG + Intronic
1097365667 12:58709754-58709776 CAGGGACACCTGGCTATATGGGG + Intronic
1100104106 12:91147582-91147604 CAGGTCTACATGACTATATTGGG + Intronic
1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG + Intergenic
1110161226 13:72380687-72380709 TAGGTAGAGCAGACTTTATCTGG - Intergenic
1117210234 14:53489831-53489853 CAAGTAGACCTTATTATAGCTGG + Intergenic
1120830227 14:88991427-88991449 CATGTAGACATGGCAATATCTGG - Intergenic
1120831580 14:89001988-89002010 CAGGTAGAACAGAGTAAATCTGG - Intergenic
1126251200 15:46570262-46570284 AAGGAAGACCTGGCAATATCAGG + Intergenic
1127722263 15:61714883-61714905 CAGGTGGTCCTTACAATATCTGG - Intergenic
1128391976 15:67188461-67188483 CAGGTAGACCTGACTATATCAGG - Intronic
1132091419 15:98950662-98950684 TGGGTAGATCTGACTTTATCAGG - Intronic
1135544470 16:23356479-23356501 CAGGTGAGCATGACTATATCTGG - Intronic
1137793958 16:51199073-51199095 AAGGAAGACCTGACTCTGTCTGG - Intergenic
1139441153 16:66967937-66967959 GAGGGAGACCTGACTATACACGG - Intronic
1140969210 16:79996792-79996814 CAGGTGGACCTGACTCAGTCAGG - Intergenic
1152034853 17:77865791-77865813 CAGGCAGTGCTGTCTATATCTGG - Intergenic
1152666959 17:81576472-81576494 CATGTGGACTTGACTATATATGG + Intronic
1156714618 18:39992355-39992377 GCGATTGACCTGACTATATCAGG + Intergenic
1157267182 18:46235973-46235995 AGGGTAGACCTCACTGTATCAGG + Intronic
1160496039 18:79376146-79376168 AAGGTAGAGCTGACTTTATGAGG - Intronic
1163436254 19:17297137-17297159 CAGGCAGACCTGATTGTGTCAGG + Intronic
932939726 2:76149452-76149474 CTGGTAGAGCTGAGTATTTCAGG - Intergenic
933394691 2:81716045-81716067 CAGTTAGAAGTGACTATATTAGG - Intergenic
934059953 2:88284250-88284272 CTGGTCGACCTGCCTATTTCTGG - Intergenic
935113275 2:100111261-100111283 CTGGTAGTCCTGACTATACACGG - Intronic
948762392 2:240199973-240199995 CAGGTAGACCTGAGAATAAAAGG - Intergenic
1169076546 20:2763351-2763373 CAGTGAGACCTGTCTATAGCGGG - Intergenic
1170107265 20:12765037-12765059 CAGGTAGTCATGACTGTAGCTGG + Intergenic
1172642217 20:36447230-36447252 CAGTAAGCCCTGACTATAGCAGG - Intronic
1174699330 20:52591504-52591526 CAGGTATACCCCACTATACCTGG + Intergenic
1183135053 22:35879145-35879167 GAGGAAGACATGAGTATATCTGG + Intronic
959845806 3:111032040-111032062 CAGGTAGACTAGACTACAACTGG + Intergenic
963923740 3:150929800-150929822 CAGGGACACCTGACTACATCAGG + Intronic
964496240 3:157293344-157293366 GAGGTACACATGACTATATGAGG + Intronic
972435927 4:39035362-39035384 CAGGGACATCTGACAATATCTGG - Intergenic
982537195 4:156621488-156621510 AAGGGAGACCTGACCATGTCTGG + Intergenic
984741292 4:183166152-183166174 CAGATAAACCTGGCTATATCTGG - Intronic
986646549 5:9921704-9921726 CAGGTAGACCTGCCTCTATAGGG + Intergenic
989750417 5:44886157-44886179 CAGAGAGATCTGACTATAGCAGG - Intergenic
993674945 5:90805802-90805824 CATGTTCACCTGACTATTTCTGG + Intronic
995452195 5:112314201-112314223 CAGGTAGACCAAACTATTACGGG + Intronic
995987211 5:118192301-118192323 CAAGTAGACCTTATTATATCCGG + Intergenic
1000565756 5:162845570-162845592 GAGGTAGGCCTGATTATATATGG - Intergenic
1002578430 5:180192105-180192127 CAGGTGGGCCTGACTAAATCAGG - Intronic
1003115150 6:3278742-3278764 CTGGTAGACCTGGCTCTTTCAGG + Intronic
1003297638 6:4847059-4847081 CAGATAGACATGACTGTAACTGG - Intronic
1004795671 6:19080539-19080561 CAGGGCGACGTGACTATTTCTGG - Intergenic
1015723426 6:136271334-136271356 CAGGTAGACTAATCTATATCAGG - Intronic
1017279695 6:152609734-152609756 CATATAGACCTGCCTATATGAGG - Intronic
1018099659 6:160426160-160426182 CAGCTATACCTGACTTTCTCTGG + Intronic
1028778555 7:94707303-94707325 CAGGAAGAACTGATTATCTCTGG - Intergenic
1032519989 7:132536575-132536597 CTGGTAGATCAGCCTATATCTGG - Intronic
1034898203 7:154891086-154891108 CAGGTACACATGACTACGTCCGG - Intronic
1038952970 8:32435832-32435854 CAGGTAAACATAACTATATTAGG - Intronic
1047034163 8:120916248-120916270 CAGGTAAATCTGAGTATGTCTGG + Intergenic
1048953994 8:139518984-139519006 CAGGAAGAACTGACAATTTCTGG + Intergenic
1051963726 9:22800841-22800863 CAGGAAGACAGGACTATTTCTGG - Intergenic
1054369457 9:64377752-64377774 CAGGTAGACCAGCCAATATTTGG + Intronic
1055977791 9:81971602-81971624 AAGGTAGACCTGTCTTTATGAGG + Intergenic
1187235671 X:17464825-17464847 AAGGCAGACCTGGCTATATATGG - Intronic
1193992937 X:88331061-88331083 CAAGTATACCTGAAAATATCTGG - Intergenic
1196370667 X:114976193-114976215 CAGTTAGACCAGATTATCTCGGG - Intergenic
1199494720 X:148440268-148440290 CAGGGAGACCTAACCATGTCTGG - Intergenic
1199508146 X:148589548-148589570 CATGTAGACCTCACTGCATCAGG + Intronic
1199537733 X:148922362-148922384 CAGTTAGACCTGAGTAAGTCTGG + Intronic
1199849968 X:151718708-151718730 GAGGTAGACCTGACTGTTTTAGG + Intronic