ID: 1128393686

View in Genome Browser
Species Human (GRCh38)
Location 15:67201512-67201534
Sequence TTACACAGCATGAAAGAAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128393686_1128393688 -1 Left 1128393686 15:67201512-67201534 CCTGTTTCTTTCATGCTGTGTAA 0: 1
1: 0
2: 1
3: 28
4: 297
Right 1128393688 15:67201534-67201556 AATGGTTCTAGAGCCCACCTAGG 0: 1
1: 0
2: 1
3: 10
4: 121
1128393686_1128393694 27 Left 1128393686 15:67201512-67201534 CCTGTTTCTTTCATGCTGTGTAA 0: 1
1: 0
2: 1
3: 28
4: 297
Right 1128393694 15:67201562-67201584 ACCAGTTCTCAGCTGGTGTGCGG 0: 1
1: 0
2: 0
3: 13
4: 160
1128393686_1128393692 20 Left 1128393686 15:67201512-67201534 CCTGTTTCTTTCATGCTGTGTAA 0: 1
1: 0
2: 1
3: 28
4: 297
Right 1128393692 15:67201555-67201577 GGCCAGAACCAGTTCTCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 189
1128393686_1128393696 28 Left 1128393686 15:67201512-67201534 CCTGTTTCTTTCATGCTGTGTAA 0: 1
1: 0
2: 1
3: 28
4: 297
Right 1128393696 15:67201563-67201585 CCAGTTCTCAGCTGGTGTGCGGG 0: 1
1: 0
2: 0
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128393686 Original CRISPR TTACACAGCATGAAAGAAAC AGG (reversed) Exonic
903201400 1:21742685-21742707 TTACACAGACTGGAAGAACCTGG - Intronic
904168906 1:28577369-28577391 TTTCACTTCCTGAAAGAAACTGG + Intronic
905067552 1:35196175-35196197 TGAGATAGCATAAAAGAAACGGG - Intergenic
908408337 1:63837102-63837124 TTTCAAAGCAGGATAGAAACTGG - Intronic
909303399 1:74041631-74041653 TTACACAGAACAAAAGAAGCAGG - Exonic
909747066 1:79110423-79110445 TTACACAGCATCACAGTAATTGG + Intergenic
909864299 1:80647719-80647741 TTACACAGCATCAAAACAATTGG + Intergenic
909966758 1:81922261-81922283 TTACAGAGTGTGAAAGAAAGGGG - Intronic
910726234 1:90342336-90342358 TTACACAGCAAGAAAAAAAAAGG + Intergenic
912208267 1:107532092-107532114 TTAAAGAGCATGAGAGAAAAAGG - Intergenic
912833021 1:112970328-112970350 TTTAATAGCAAGAAAGAAACTGG + Intergenic
913414099 1:118586063-118586085 TTAACCAGAATGTAAGAAACAGG - Intergenic
913532120 1:119740880-119740902 TCACACAGCAGGGAAGAGACAGG - Intronic
914948415 1:152087520-152087542 TTCCACAGCATGAAGGACACAGG + Exonic
915140184 1:153763107-153763129 TCACACAGCATTGAGGAAACAGG + Intronic
915241995 1:154529839-154529861 TTACAAAGTAAGAAAGAAGCTGG - Intronic
915909017 1:159900598-159900620 TTCCACAGCAGGAGAGAATCTGG + Intergenic
916101212 1:161394837-161394859 CTACATAGCATGCAAAAAACTGG + Intergenic
916420915 1:164636944-164636966 TTACACAGCAATAAAGTAAATGG + Intronic
916544257 1:165786994-165787016 TTACTCAGCATCAAATAAAATGG + Intronic
917691841 1:177477838-177477860 TTACATAGCATCAAAGGAGCAGG + Intergenic
918096315 1:181337657-181337679 TTAGACAACACGAATGAAACTGG - Intergenic
919645412 1:200089769-200089791 TGACAGTGCAAGAAAGAAACAGG - Intronic
920959026 1:210647794-210647816 TTACACAGATTAAAGGAAACTGG - Intronic
921307904 1:213815282-213815304 TCACACTGCATCGAAGAAACTGG - Intergenic
921809875 1:219500638-219500660 TTACACTGGATGAAAGAAACTGG + Intergenic
922120556 1:222663425-222663447 TCACACAGCATGTAAGAGGCTGG - Intronic
923386120 1:233466344-233466366 TTCCACAGCATGCAAGAAGATGG - Intergenic
1063183738 10:3631412-3631434 TTACAGACCATGAAGGCAACAGG + Intergenic
1063208497 10:3857256-3857278 TTACACAGCCTGAGTGATACCGG + Intergenic
1063490847 10:6462438-6462460 ATACACAGCATGTCAGAAAAAGG - Intronic
1064029071 10:11871599-11871621 TTACACAGCAGGAAAAGAACCGG + Exonic
1064587485 10:16852853-16852875 TTACACAGTGTGATAGAAAGAGG + Intronic
1064748067 10:18497338-18497360 ATCCACAAGATGAAAGAAACAGG - Intronic
1066678248 10:37911346-37911368 TGCCACAACATGAATGAAACTGG - Intergenic
1067749268 10:48959374-48959396 TTACACAGCATTAAACAATCAGG - Intronic
1068057470 10:52028740-52028762 TTACATATAATGAAAGAAAACGG - Intronic
1068628819 10:59278538-59278560 TTAAACATCCTGAAATAAACAGG - Intronic
1069304087 10:66946864-66946886 TTCCACAGCATGAATGACTCAGG + Intronic
1072866293 10:99065873-99065895 TTCCAAATGATGAAAGAAACTGG - Intronic
1075132654 10:119753690-119753712 TTACACAAGGTAAAAGAAACTGG + Intronic
1075876552 10:125811281-125811303 ATATAGAGAATGAAAGAAACTGG + Intronic
1079745108 11:24116984-24117006 TGACACAGCATGCGTGAAACTGG + Intergenic
1080694872 11:34594716-34594738 TGACACAGCCAGATAGAAACTGG - Intergenic
1080886776 11:36375280-36375302 TCACACACAATGAAAGAGACTGG - Intronic
1080992640 11:37557916-37557938 TTTCACAGCTTGAAAAAAAGGGG - Intergenic
1081216810 11:40410232-40410254 TTAAATATCATAAAAGAAACAGG + Intronic
1081843425 11:46220211-46220233 TTACAGAGCCTGAAAGAGAAGGG - Intergenic
1081898107 11:46604511-46604533 CTACAGAGCAAGAATGAAACAGG + Intronic
1081942000 11:46951170-46951192 TTACAAAACCTGAAAGAAAGTGG - Intronic
1082976877 11:59081339-59081361 TTACATAGCAGGGAAGAAATGGG - Intergenic
1082978157 11:59095725-59095747 ATACACTTCATGAAAAAAACGGG + Intergenic
1083357982 11:62081804-62081826 ACACACAGCAGGAAAGACACCGG - Intergenic
1085421771 11:76368466-76368488 ATACACAACATTAAAGAACCAGG + Intronic
1085981443 11:81731008-81731030 TTTCACAGGATGAATGAAAATGG + Intergenic
1086205322 11:84251038-84251060 TTACAAAACATGAATGAAAGAGG + Intronic
1087319822 11:96644305-96644327 GTACAGGGCATGAAAGGAACTGG - Intergenic
1092019763 12:5191657-5191679 TTACAGATCTTGAAAGAAAGAGG + Intergenic
1093415011 12:18909640-18909662 TTACACAGAATGAAGAAAACAGG - Intergenic
1094670833 12:32567202-32567224 TAACACTGCAAGAAAGCAACAGG - Intronic
1095465766 12:42486651-42486673 ATACACAACATGGAAGAACCAGG - Intronic
1095577031 12:43752177-43752199 TTTAAAAGCCTGAAAGAAACTGG + Intronic
1096928642 12:55178337-55178359 TTACAAGGCATAAAAGAGACAGG - Intergenic
1099380201 12:81943614-81943636 GCAGACAGCATGAAAAAAACTGG + Intergenic
1100055046 12:90498765-90498787 TTGCACAGCATGAATGCAAAGGG - Intergenic
1100312571 12:93410898-93410920 TGATAAAGCATGAAAAAAACAGG + Intronic
1100459982 12:94789998-94790020 TTTCACAGCATGAAAGGCACGGG - Intergenic
1101010153 12:100441114-100441136 AAACAGAGCAGGAAAGAAACTGG - Intergenic
1101533109 12:105592913-105592935 TTACACTGAGTGAAAGAAGCGGG + Intergenic
1101621629 12:106394502-106394524 CTACACAGCATTAAAGAATAGGG - Intronic
1101995243 12:109520827-109520849 AGACAAAGGATGAAAGAAACCGG - Intronic
1102960270 12:117088288-117088310 TTTCAGAGCATCTAAGAAACAGG + Intronic
1103026604 12:117579310-117579332 TCACACAGCTCGAAAGAAACAGG - Intronic
1103688107 12:122748839-122748861 TTACACAGGAGGAAACAAAGAGG - Intergenic
1104849657 12:131866096-131866118 TTACATAGCAATAAAGAAAAAGG + Intergenic
1105237341 13:18569607-18569629 TTACACACATTGAAAAAAACAGG - Intergenic
1105298629 13:19113639-19113661 GTACTCACCATGAAAGAAAAAGG + Intergenic
1106226135 13:27788727-27788749 TTACACACCATGAAAAGATCTGG + Intergenic
1107307805 13:39040860-39040882 AAACACAGCATGAAATAAATGGG - Intronic
1108993141 13:56689688-56689710 TTACACAACATGGATGTAACTGG + Intergenic
1110877649 13:80529519-80529541 TGAAACAGCATGAATGAATCTGG - Intergenic
1112129279 13:96503629-96503651 TTCCAGAACATCAAAGAAACTGG + Intronic
1112317500 13:98376419-98376441 TTGCACAGCATGATTGGAACTGG - Intronic
1113270856 13:108672737-108672759 TTACGCCACATGAAAGAAAAGGG + Intronic
1114149820 14:20025453-20025475 TGAGACAACATGAATGAAACTGG - Intergenic
1117701483 14:58417864-58417886 TTATACATCAGGAATGAAACAGG + Intronic
1117982654 14:61357218-61357240 TTAAATAGCATGGGAGAAACGGG - Intronic
1118013900 14:61639354-61639376 CTAAACAGGATGAAAGACACAGG - Intronic
1118527003 14:66656445-66656467 TCCCACATCACGAAAGAAACAGG - Intronic
1119784048 14:77299307-77299329 GAACATAGCAGGAAAGAAACAGG + Intronic
1120649433 14:87113843-87113865 TTAGACATCAGGACAGAAACTGG + Intergenic
1120688898 14:87570508-87570530 TCCCACAGCAAGAAAGAAACAGG - Intergenic
1123456432 15:20430519-20430541 TTACACAGCAAGAAAGATTTTGG + Intergenic
1123661631 15:22569839-22569861 TTACACAGCAAGAAAGATTTTGG - Intergenic
1123977388 15:25566172-25566194 TTACAAAGCATGCAAGAGGCTGG - Intergenic
1124262571 15:28205670-28205692 TTACACAGCAAGAAAGATTTTGG + Intronic
1124315430 15:28664072-28664094 TTACACAGCAAGAAAGATTTTGG - Intergenic
1126368277 15:47918545-47918567 TAACACAGCATTCAAGAAAAAGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126665990 15:51077034-51077056 TTACACAGTGAGAAAGAAGCAGG - Intronic
1128393686 15:67201512-67201534 TTACACAGCATGAAAGAAACAGG - Exonic
1129494405 15:75964255-75964277 TTCCACAGAGTAAAAGAAACTGG + Intronic
1131436568 15:92427450-92427472 TTAGATTTCATGAAAGAAACTGG + Intronic
1131787650 15:95930467-95930489 TTACACAGCATGTCAAAAATAGG - Intergenic
1133619282 16:7510947-7510969 CTCCACAGCAGGAAATAAACTGG + Intronic
1135177286 16:20241601-20241623 TCACACAGCATGTAAGAGGCAGG + Intergenic
1136646716 16:31625636-31625658 TTTCAGAGGAAGAAAGAAACAGG + Intergenic
1137846703 16:51696765-51696787 TCACACAGCAAGAAAGCGACAGG - Intergenic
1138101063 16:54252858-54252880 TGACTCAGCATGAAATAAGCAGG - Intronic
1138360406 16:56423766-56423788 TTACACAGCAGTAGATAAACAGG + Intronic
1138744306 16:59345392-59345414 TTCTGCAGCATGAAAGAGACTGG + Intergenic
1142527545 17:554953-554975 TTACACAGCCTGAACAAAGCGGG - Intronic
1143629091 17:8126845-8126867 TAAAACAGGTTGAAAGAAACGGG - Intergenic
1143840119 17:9725253-9725275 TTACACTGCATTAAAGACACAGG - Intronic
1143936696 17:10493650-10493672 TTGCAGGGCAAGAAAGAAACAGG - Intronic
1146290614 17:31604197-31604219 ATCCAAAGCATGAAAGAAATGGG - Intergenic
1146498005 17:33340142-33340164 TCAGAAAGCAAGAAAGAAACAGG + Intronic
1149414856 17:56448677-56448699 TTTCACAGTAGGAAAGAAAGGGG - Intronic
1151292108 17:73157678-73157700 TCACACAGCAGGAAAGCACCAGG + Intergenic
1154007773 18:10547363-10547385 TTACTCAACATGCAAGAACCTGG + Intronic
1155245741 18:23907304-23907326 ATACACAGGAAGAAAGAAAGAGG - Intronic
1156734871 18:40243633-40243655 TGAGACAACATGAACGAAACTGG - Intergenic
1156764712 18:40638177-40638199 TTATACAGAATGAAAAAAAATGG + Intergenic
1156842371 18:41624487-41624509 AGACACTGCATGAAATAAACTGG - Intergenic
1156999117 18:43503203-43503225 TTAAAAAGCATGAAAGAACCAGG - Intergenic
1157119849 18:44898743-44898765 TTAAACAGAAAGAAGGAAACAGG + Intronic
1158411455 18:57209594-57209616 TTACACGACATGAAATGAACTGG + Intergenic
1158775946 18:60579911-60579933 CAATACAGCATAAAAGAAACAGG + Intergenic
1163216471 19:15881835-15881857 TGCCACAACATGAAAGAACCTGG + Intronic
1164125508 19:22312147-22312169 TAACACTGAATGAGAGAAACAGG - Intronic
1164227317 19:23257289-23257311 TTATACAGTATGCAAGAAAGTGG + Intergenic
1164436820 19:28237548-28237570 TTACACAGCCAGGAAGAAGCAGG + Intergenic
1168591966 19:57643860-57643882 TTATGCATCATGAATGAAACTGG - Intergenic
925247411 2:2396344-2396366 TTACAGAGCATGGAATAAATAGG + Intergenic
926469966 2:13242688-13242710 TTTCACTGCATGAGAGAAAGGGG - Intergenic
926613383 2:14970519-14970541 TAAAACATCAAGAAAGAAACAGG + Intergenic
927019479 2:19001788-19001810 CATCACAGCCTGAAAGAAACTGG + Intergenic
929980095 2:46670116-46670138 CTACATGGCATGGAAGAAACAGG + Intergenic
930804641 2:55478192-55478214 TGACAAAGCCTGAAAGAAAGAGG - Intergenic
931298687 2:60955916-60955938 TTAAACACCATGAAAGGAAAAGG + Intronic
931983074 2:67714754-67714776 TTGCACAGCATGAATGGAGCTGG - Intergenic
932097217 2:68861840-68861862 TTACACATCAGGAAAGAATTCGG + Intergenic
933066898 2:77808844-77808866 GTATACAGTAAGAAAGAAACGGG - Intergenic
933450805 2:82447897-82447919 ATACCTAGCTTGAAAGAAACAGG + Intergenic
937347168 2:121133208-121133230 TCACACAGCAGGTAAGAGACAGG - Intergenic
937817321 2:126265976-126265998 TTCTACAGCATGGATGAAACTGG - Intergenic
938512436 2:131964896-131964918 TTACACACATTGAAAAAAACAGG + Intergenic
938926971 2:136052306-136052328 ATACACAGGATGAAAGATCCAGG + Intergenic
939768058 2:146278219-146278241 TTACATGGCATAGAAGAAACAGG - Intergenic
939933227 2:148257970-148257992 TTAGAAAGCCTGATAGAAACTGG - Intronic
940586222 2:155655048-155655070 ATACACAGAACGAAAGAAAGAGG - Intergenic
940913237 2:159227583-159227605 TTACACAGTGAGAAAGAAGCTGG - Intronic
941059611 2:160831165-160831187 TTACTAGGCATGAAAGAAGCAGG - Intergenic
941249932 2:163148741-163148763 ATTCACAGCAGGAAAGAACCTGG + Intergenic
941951129 2:171159416-171159438 TTACACAGCTTGTAAGGCACCGG - Intronic
942743425 2:179205289-179205311 TTAAACAGCATCCAAGAAACAGG + Intronic
942946844 2:181682067-181682089 TTAAAAAGAAAGAAAGAAACTGG + Intergenic
943075814 2:183193158-183193180 GTAAACAGAATGAAAGAAATTGG - Intergenic
943731092 2:191304599-191304621 GTACATATCCTGAAAGAAACTGG - Intronic
945427476 2:209724264-209724286 TTACACTAAATGAAAGAGACAGG - Intronic
946612167 2:221470672-221470694 CTACATAGCAAGCAAGAAACAGG - Intronic
946632204 2:221682451-221682473 TTACACAGCAATAAAAATACAGG + Intergenic
1173124435 20:40323698-40323720 TTAAAGAGCCTGAAAGAAAAAGG + Intergenic
1173228345 20:41175102-41175124 TGACCCAGCCTGAAAGATACAGG + Exonic
1174003724 20:47393667-47393689 ATACACTGCATGAAAGCAAAGGG + Intergenic
1174146486 20:48455867-48455889 TTACACAGCACGTGAGACACCGG - Intergenic
1174805879 20:53604067-53604089 TTCCACAACATGGAGGAAACTGG - Intronic
1175029463 20:55937924-55937946 TTAGAAAGACTGAAAGAAACTGG + Intergenic
1176732931 21:10518670-10518692 TTCCACAGCATGGAGGAAACTGG + Intergenic
1176781328 21:13197890-13197912 TTACACACATTGAAAAAAACAGG - Intergenic
1178021278 21:28411311-28411333 ATTCACAACCTGAAAGAAACAGG - Intergenic
1178642604 21:34357227-34357249 TTACACAACTAGAAAGAAAGTGG + Intergenic
1182985272 22:34710413-34710435 TCACACAGCATAGAAGAAAAGGG - Intergenic
1183813338 22:40276596-40276618 TTTCACAGCATAAAAGACATTGG - Intronic
949271120 3:2218037-2218059 TTTCACAGGATGAGAAAAACAGG + Intronic
949556276 3:5156281-5156303 TCACAAAGCATAAAAGAGACAGG - Intronic
950375099 3:12564890-12564912 TTACGCAGAGTGAAAGAAGCTGG - Intronic
951131505 3:19051494-19051516 TTACTGAGCATTAAAAAAACTGG - Intergenic
951391918 3:22115488-22115510 TTATAGAGAATGAAAGAAAATGG + Intronic
951562133 3:23979068-23979090 TCACACGTCATGAAAGTAACAGG - Exonic
952359215 3:32613096-32613118 ATACACAGAATGAAAAAATCTGG - Intergenic
952649749 3:35711177-35711199 TTAAAAAGCATGCTAGAAACAGG - Intronic
952654330 3:35766420-35766442 TAACACAGAATGAAATAATCAGG + Intronic
953445326 3:42959361-42959383 TTCCAGAGAATGAAAGAAAAAGG - Intronic
953809851 3:46102935-46102957 TGACTCAGCATGACAGAATCAGG - Intergenic
954995423 3:54876913-54876935 TTAGACAGAATGAATGAAACAGG + Intronic
955460163 3:59173344-59173366 TTCAACAGCATGAGTGAAACTGG - Intergenic
956689831 3:71865253-71865275 TTACTCAGCATACAAAAAACAGG + Intergenic
957174105 3:76782743-76782765 ATACACAGCCTGAAAGTAAGTGG - Intronic
957824355 3:85421784-85421806 TTACAAAGCAAGAAAGAAAAGGG + Intronic
958478591 3:94617732-94617754 ATAAACAGCAAGAAAGAAAATGG - Intergenic
959977016 3:112472377-112472399 TAACACAGTATGAAAAATACTGG + Intronic
961498014 3:127308587-127308609 TTACACATTTTTAAAGAAACTGG + Intergenic
961587068 3:127939467-127939489 TTACAAAGCATGAAAGAGGGAGG + Intronic
963990453 3:151647199-151647221 TTATACTGAATGAAAGAAATAGG + Intergenic
964025784 3:152072389-152072411 ACACATAGCAAGAAAGAAACAGG + Intergenic
964434631 3:156638631-156638653 TTACACAGAAGGAAAAAGACAGG - Intergenic
965274174 3:166659444-166659466 TGCAACAGCATGAATGAAACTGG + Intergenic
968885647 4:3330040-3330062 TCACACAGCAAGAAAGAACCAGG - Intronic
969835996 4:9842084-9842106 TTACACAGATTGAAAAAAAATGG - Intronic
969860928 4:10034821-10034843 TCACACAGCAAGAAAGAAGCAGG + Intronic
970416237 4:15860042-15860064 TTTCAGAACATGAATGAAACTGG + Intergenic
970471467 4:16383601-16383623 TTTCACAGCATGAATGACCCTGG - Intergenic
970634724 4:17995474-17995496 AAACTCAGCATTAAAGAAACCGG + Intronic
970772344 4:19628919-19628941 TTACACAGCATGATAACTACTGG + Intergenic
972267444 4:37475538-37475560 TTACAAATCTTAAAAGAAACAGG - Intronic
975192014 4:71475503-71475525 TTACACAGCCTGGGAAAAACTGG - Intronic
976850609 4:89541160-89541182 ATACACTGTACGAAAGAAACTGG - Intergenic
977349115 4:95857724-95857746 TTACACTTCAGGAAAGAAAGAGG + Intergenic
978035624 4:103989779-103989801 TTCCACAACATGGATGAAACTGG - Intergenic
979026100 4:115578210-115578232 TCACACAGAAAGAAAGAAAATGG - Intergenic
979271823 4:118771429-118771451 TTACACAACATGAAAGTGATAGG + Intronic
979443332 4:120779534-120779556 TTACTCAGCATTAAAAATACAGG + Intronic
981591486 4:146368305-146368327 GTACACAGCATGAGAGTATCTGG + Intronic
981983043 4:150819388-150819410 TTACATACAATGAAAGACACAGG - Intronic
982710386 4:158752571-158752593 TTACACTGCAAGAATGAGACAGG - Intergenic
982829286 4:160041236-160041258 TTACACAGCATGTGAAAAGCTGG + Intergenic
983374840 4:166912729-166912751 TTTAACAGGATGAAAGAAGCAGG - Exonic
984313696 4:178098827-178098849 TTAAACAACACGAAAGAATCAGG + Intergenic
984435332 4:179702778-179702800 GTCCACAGCATTTAAGAAACAGG - Intergenic
986510981 5:8505917-8505939 TTAAACAGAAGGAAAGAAAGTGG - Intergenic
987053533 5:14168467-14168489 TTACACAGCCTGATATAAATCGG + Intronic
987160860 5:15140660-15140682 TGTCACAGCATGAATGAACCTGG + Intergenic
987464469 5:18255174-18255196 TGACACAGCATGGAAAAAAATGG + Intergenic
987549489 5:19360398-19360420 TTAGCCAGCATGAAACAAACAGG + Intergenic
988244195 5:28656646-28656668 TTATACAGCATAAAATAAATTGG - Intergenic
989040410 5:37221944-37221966 ATACACAGTATGAAACAAAAGGG + Intronic
989159151 5:38373559-38373581 TTAAGCAACATGAATGAAACTGG - Intronic
990011671 5:51006050-51006072 TTCCCCAGCATGAAAGAGGCAGG - Intergenic
990221021 5:53588567-53588589 TTTCACTTCATGAAACAAACTGG - Intronic
992156685 5:73962315-73962337 GTAGGCAACATGAAAGAAACAGG + Intergenic
993146564 5:84101290-84101312 TTAGACAGCTTGAATCAAACAGG - Intronic
993414359 5:87608162-87608184 TTACACATTAAAAAAGAAACAGG + Intergenic
993506266 5:88712607-88712629 TTATGCTGCATGAAAGAATCTGG - Intergenic
993914864 5:93731738-93731760 TTACACATCCTGAAAGGAAAAGG + Intronic
996538442 5:124603384-124603406 TCACAGAGCATGGAAAAAACTGG + Intergenic
998413178 5:141926592-141926614 GTACACAGCACGAAAGCAGCAGG - Intronic
998634407 5:143937026-143937048 TTGCACAGCATGGATGGAACTGG + Intergenic
999979976 5:156948762-156948784 TCACACAGCAGGAAAGAGGCAGG + Intronic
1000830633 5:166096986-166097008 TTGCACAGCAGGCAAGAAGCAGG - Intergenic
1001141668 5:169149538-169149560 GTCCACAGAATCAAAGAAACTGG + Intronic
1002886285 6:1297756-1297778 TTAAACAGCATGAAAGGGACAGG + Intergenic
1003299502 6:4864617-4864639 CAACACAGCATGAGAAAAACCGG - Intronic
1003732261 6:8838426-8838448 TTAAATAGCATGAAGGAAAATGG - Intergenic
1004322244 6:14641065-14641087 AAACACAGAATGAAACAAACCGG + Intergenic
1006728328 6:36216100-36216122 TTACACAGCTAGTAAGAAATTGG - Intronic
1007492781 6:42236888-42236910 TAACACACCATGCAAGATACTGG + Intronic
1008739481 6:54588265-54588287 TAAGACAGCATCAAAAAAACAGG + Intergenic
1009315898 6:62221152-62221174 TGCCACAACATGAATGAAACTGG + Intronic
1009590380 6:65662010-65662032 TTAGACAGTAGGGAAGAAACTGG + Intronic
1010139505 6:72597949-72597971 ATACACAGTAAGAAAGAAATGGG + Intergenic
1012373886 6:98538025-98538047 TCACATAGCTTGAAAGAAGCAGG + Intergenic
1012613049 6:101239808-101239830 TCAGATATCATGAAAGAAACAGG + Intergenic
1012994814 6:105962698-105962720 GTACAAAGAATGAAAGAATCGGG - Intergenic
1014174797 6:118320329-118320351 TAAAAAAGCAAGAAAGAAACAGG + Intergenic
1014231431 6:118906925-118906947 TTATATAGCACAAAAGAAACAGG + Intronic
1015325746 6:131921528-131921550 TGAAACAACATGAATGAAACTGG + Intergenic
1016814252 6:148289120-148289142 TTACACAGTAAAAAAGAAAAAGG - Intronic
1017103925 6:150870306-150870328 TGACAAAGCAAGAAAGAAAAAGG - Intronic
1017461062 6:154651068-154651090 TGCAACAGCATGAACGAAACTGG - Intergenic
1017633067 6:156417910-156417932 CTACACAGCACAAAAGAAAAAGG + Intergenic
1017837639 6:158193536-158193558 TTACACAGCATTACTGAATCTGG + Exonic
1019608702 7:1924043-1924065 TTAAGCAGCATGAAAAGAACCGG + Intronic
1020517288 7:9138991-9139013 TTGCACAGCATGTTTGAAACAGG - Intergenic
1021986697 7:26104271-26104293 TTACACACCATGTAAGTGACAGG + Intergenic
1022135041 7:27439292-27439314 TTACAAAGCAGGGAAGAAAAGGG + Intergenic
1022205004 7:28155238-28155260 TTTCAGGGCATGAAAGAGACTGG + Intronic
1023204836 7:37737284-37737306 TTATACTGTATCAAAGAAACAGG - Intronic
1025770952 7:64506100-64506122 TTACACAGCAGGTGTGAAACAGG + Intergenic
1027358385 7:77382728-77382750 TTACATACCATTGAAGAAACTGG + Intronic
1027653864 7:80904674-80904696 TTACACAACATGAAAGTGTCAGG - Intronic
1027842384 7:83329773-83329795 TTACACAGCATGGAGGAAAAGGG + Intergenic
1030374342 7:108737846-108737868 TGACCCAGCATGAGTGAAACTGG - Intergenic
1030975954 7:116123316-116123338 TGACTCAGAATGAAAGAAAAAGG - Intronic
1032635923 7:133708707-133708729 TTACACAGCTTGTAAGTAACTGG + Intronic
1033230859 7:139596410-139596432 TTACAGAGGATGAAATACACTGG + Intronic
1035561421 8:606932-606954 TTACACATCCTGAAAGACAGTGG - Intergenic
1036919339 8:12836391-12836413 GTGCACAGTAAGAAAGAAACAGG - Intergenic
1037148572 8:15606015-15606037 TTAAACAGAATGAAAAATACAGG - Intronic
1037314251 8:17585885-17585907 TTACAAAGCAAGAAGGAAGCAGG - Intronic
1037440526 8:18911449-18911471 TTACACAGCAAGGAAGTCACGGG - Intronic
1037631836 8:20664663-20664685 TTACACAGGATGAATGATTCTGG - Intergenic
1037851301 8:22331555-22331577 TTAGAAAGCATGAAAAAAATTGG + Intronic
1038664472 8:29525991-29526013 TTAAACAACATGAGAGATACAGG + Intergenic
1041232540 8:55768339-55768361 TCACAAAGGAGGAAAGAAACAGG + Intronic
1041647599 8:60269477-60269499 TTAAAGAGCATTAAAGAAAATGG - Intronic
1041837556 8:62233421-62233443 TTACACAGCATAACGGAAGCAGG + Intergenic
1042712150 8:71730059-71730081 TTGCATACAATGAAAGAAACGGG - Intergenic
1043448336 8:80341008-80341030 TTACTCTGCATGAAAAAAAATGG - Intergenic
1043621306 8:82196009-82196031 TTAAAGAGCAAAAAAGAAACAGG - Intergenic
1044900917 8:96943576-96943598 TTGCACAGCAAGAAAGTAGCAGG + Intronic
1045289832 8:100823543-100823565 TGGCACAGGAGGAAAGAAACGGG - Intergenic
1045963760 8:107999980-108000002 TAACACAGCACAAAAGAAACAGG + Intronic
1046177109 8:110591971-110591993 TAACACATCATTAAATAAACTGG - Intergenic
1048418815 8:134256784-134256806 TGATACAGCATGAAACAGACAGG + Intergenic
1048719447 8:137306722-137306744 TTATACTGAATGAAAGAATCTGG + Intergenic
1048722889 8:137347234-137347256 TGAGGCAGCATGAATGAAACTGG - Intergenic
1050303223 9:4280405-4280427 TTATATAACATGAAAGATACTGG + Intronic
1051442716 9:17103208-17103230 TTCAACAACATGAATGAAACTGG - Intergenic
1053037171 9:34835274-34835296 TTATTCAGGTTGAAAGAAACTGG + Intergenic
1053415264 9:37943455-37943477 TGCCACAGCATGATGGAAACAGG + Intronic
1054883464 9:70170533-70170555 TTACTCAGGAGAAAAGAAACCGG + Exonic
1055036741 9:71825816-71825838 TTCCCCACCATGAAAGAAATAGG + Intergenic
1055839059 9:80480843-80480865 TTACTCAGCATGAAAAAAGATGG - Intergenic
1055956392 9:81777507-81777529 ATACACAGCAAGAAAGAAATTGG + Intergenic
1058856903 9:109071233-109071255 TTATACAGCATTAAAAAAAATGG - Intronic
1060472480 9:123959882-123959904 TCACACAGCTGGAAAGAAACTGG + Intergenic
1060680837 9:125562834-125562856 TTAAACAGCATGTAAGTGACAGG + Intronic
1061428413 9:130515740-130515762 TTCCACAGCATTAAGGAAGCTGG + Intergenic
1185544482 X:931358-931380 TATCACAGCCTCAAAGAAACAGG - Intergenic
1185929879 X:4190449-4190471 TGCAACAGCATGAATGAAACTGG + Intergenic
1186689483 X:11959896-11959918 TTCCCCACCATGAAAGAAACAGG - Intergenic
1189535555 X:41931575-41931597 TCACACAACAAGAAAGAGACAGG + Intergenic
1190049507 X:47139325-47139347 TTGTACAGAATGAAAGAAACTGG + Intergenic
1190522150 X:51291340-51291362 TTACACTGCATGAAACATACAGG + Intergenic
1190966594 X:55307124-55307146 TTATAGAGCAAGAAAGAAAAAGG - Intergenic
1191915706 X:66199219-66199241 TTACACAGTATGGGGGAAACTGG + Intronic
1193192932 X:78594331-78594353 CTACACAGCATGAAAATAAAGGG - Intergenic
1193331241 X:80237735-80237757 TTGCACAGCATCAAAGACACAGG - Intergenic
1194078600 X:89429608-89429630 TGCCACAGCATGAATGAAGCTGG - Intergenic
1194453874 X:94078935-94078957 TGCCACAGCATGGATGAAACTGG + Intergenic
1196631615 X:117947043-117947065 TTAAAAAGCATAAAAGAAACTGG + Intronic
1197833087 X:130666115-130666137 CCACACAGCATGGAAGAAAATGG + Intronic
1198305299 X:135376253-135376275 CTATTCAGCATGAAAAAAACAGG + Intergenic
1200572963 Y:4855326-4855348 TTATAGACCTTGAAAGAAACAGG - Intergenic
1201709616 Y:16976053-16976075 TGCAACAGCATGAATGAAACTGG + Intergenic
1201734859 Y:17248188-17248210 TTTTACAGCATGATAGAATCTGG - Intergenic