ID: 1128396198

View in Genome Browser
Species Human (GRCh38)
Location 15:67228979-67229001
Sequence GAGGGGAGACAGTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2011
Summary {0: 1, 1: 2, 2: 27, 3: 252, 4: 1729}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128396189_1128396198 2 Left 1128396189 15:67228954-67228976 CCCAACAGACACTGGGGCCTTAC 0: 1
1: 0
2: 1
3: 11
4: 90
Right 1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG 0: 1
1: 2
2: 27
3: 252
4: 1729
1128396190_1128396198 1 Left 1128396190 15:67228955-67228977 CCAACAGACACTGGGGCCTTACT 0: 1
1: 0
2: 0
3: 29
4: 166
Right 1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG 0: 1
1: 2
2: 27
3: 252
4: 1729

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128396198 Original CRISPR GAGGGGAGACAGTAGGAGGA GGG Intronic
Too many off-targets to display for this crispr