ID: 1128399248

View in Genome Browser
Species Human (GRCh38)
Location 15:67260800-67260822
Sequence GAATGCCTTAGAACCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128399248 Original CRISPR GAATGCCTTAGAACCAGGCC AGG Intronic
900573882 1:3373564-3373586 CAAGGCCACAGAACCAGGCCTGG + Intronic
901399481 1:9006146-9006168 GAACGGCTTGGAACCCGGCCAGG + Intronic
901500183 1:9647805-9647827 GAGTCCCTCAGAACCAGGACAGG + Intergenic
902163517 1:14551491-14551513 GAGTGCTTTTGTACCAGGCCCGG - Intergenic
902803788 1:18848321-18848343 GAGGTCCTTAGCACCAGGCCTGG + Intronic
904003663 1:27352042-27352064 GAAAACCTTGGAAACAGGCCAGG + Intronic
905436385 1:37958345-37958367 GTATGCCATGGAATCAGGCCAGG - Intronic
905449777 1:38048513-38048535 GAATGCCCTAGGACCAGCCAGGG + Intergenic
905944476 1:41890187-41890209 AAATTACTTAGAACCAAGCCTGG + Intronic
907927545 1:58968582-58968604 GACTGCCTGTGAACCAGGCCAGG - Intergenic
907959422 1:59264524-59264546 GAAGGCCTGAGAACCATCCCAGG - Intergenic
908681004 1:66660923-66660945 GAATGCCTATGAAGCTGGCCCGG + Intronic
912953122 1:114134252-114134274 AAATGGCTTAGAGCCAGGCTTGG - Intronic
914421584 1:147533081-147533103 GAATCCATTAGAACCAGTCTAGG + Intergenic
915822487 1:159039637-159039659 GAATGAGATAGAACCCGGCCAGG - Intronic
915837693 1:159190895-159190917 GGATGCATTAGAATCAGACCTGG + Intronic
922051410 1:221994090-221994112 GAATGCTTCAGAAACAGACCTGG + Intergenic
923730222 1:236543183-236543205 GAATGGCTCAGAGGCAGGCCTGG - Intronic
924045730 1:240027932-240027954 GAGTGGCTTAGAATCAGGACTGG + Intronic
924523940 1:244829708-244829730 GAAAGCCGAAGAACCAGGTCTGG - Intergenic
1064360534 10:14660285-14660307 CATTGCTTTAGAAACAGGCCAGG - Intronic
1065137833 10:22690125-22690147 TAAACCCTTAGAACCATGCCTGG - Intronic
1066291804 10:34021285-34021307 GAAGGCCTGAGAACCAGGGTGGG - Intergenic
1067662315 10:48245626-48245648 AAAAGACTTAGAACAAGGCCTGG - Intronic
1069558585 10:69413871-69413893 GAAGCCCTTAGCACCATGCCTGG - Intronic
1072603840 10:96960232-96960254 CAAAGGCTTAGAACCAGGCCTGG - Intronic
1073319170 10:102603829-102603851 GAATACCTTGTAACCTGGCCAGG + Intronic
1076099774 10:127766752-127766774 GAATGCCTTCCACCCAGCCCAGG - Intergenic
1078599538 11:12717963-12717985 GAAGGGCTTAGAACCATGTCTGG + Intronic
1079000800 11:16753666-16753688 AAAATCCTTAGAAACAGGCCAGG - Intronic
1083482691 11:62959844-62959866 GAAGGCCATGGAACTAGGCCTGG + Intronic
1084680766 11:70664961-70664983 CCATGCCTCAGAACCAGCCCAGG + Intronic
1087191801 11:95262481-95262503 GAAGCACTTAGAACCATGCCCGG + Intergenic
1087858794 11:103127637-103127659 AAATGCCTTAGACTCAGCCCAGG + Intronic
1088439384 11:109852166-109852188 AAATGCCTGGGAACCAGGCCAGG - Intergenic
1089001231 11:115054048-115054070 GAAGGCCCGAGAACCAGGGCAGG + Intergenic
1089214335 11:116826777-116826799 GACTGCCTTCCAGCCAGGCCTGG + Intergenic
1091130643 11:133144219-133144241 GAATCCCTGGGAACCAGCCCTGG - Intronic
1094057767 12:26284062-26284084 GAAAGCCTTAAAACCAGGGAAGG - Intronic
1095812952 12:46390595-46390617 GAAGCACTTAGAACCATGCCTGG + Intergenic
1096100005 12:48965048-48965070 CACTGCCTTAGAACAAGGGCTGG - Intergenic
1096663502 12:53145622-53145644 AAAGGCCTGAGAACCAGGGCAGG + Intergenic
1096759792 12:53831416-53831438 GAAAGGCTTAGAACAATGCCTGG - Intergenic
1100154879 12:91786520-91786542 GACTGGGTTAAAACCAGGCCAGG - Intergenic
1100961534 12:99968051-99968073 GAATGCCTTAGAACCATGAAAGG + Intronic
1101048313 12:100834283-100834305 GACTGCCCTAGTACGAGGCCAGG + Intronic
1101442336 12:104713132-104713154 GAATGCCTTGTAACCCAGCCTGG + Intronic
1102982593 12:117253836-117253858 GAAGGCCCTAGAATCAGGACTGG - Intronic
1103494577 12:121351750-121351772 AAATGCCATAAAACCGGGCCGGG - Intronic
1104196932 12:126549419-126549441 GAAGGCCTGAGAAGCAGGGCAGG + Intergenic
1107632813 13:42359636-42359658 AAATCCCTTAGAACAATGCCTGG + Intergenic
1108022367 13:46140987-46141009 GAATCCCCCAGAACCAGGGCTGG + Intronic
1109696677 13:65969925-65969947 GAATGTCTTAGAGACAGGCATGG - Intergenic
1114490568 14:23098959-23098981 ATATGCCTTAGAAAAAGGCCAGG - Exonic
1116395483 14:44444054-44444076 AAATACCTTAGCACTAGGCCTGG + Intergenic
1116797434 14:49406921-49406943 GAATTCCTTAGAAGCACGCAAGG + Intergenic
1119112282 14:71986406-71986428 TAATGGCTTAAAACAAGGCCAGG + Intronic
1121087312 14:91156407-91156429 AAATGATTTAGAAACAGGCCGGG - Intronic
1122474537 14:101997777-101997799 CAATGACCTAGAACAAGGCCTGG - Intronic
1122840414 14:104459536-104459558 CAAAGACTTAGAACCAGGCGTGG - Intergenic
1124278402 15:28344552-28344574 GAATGCCTGAGAGGCAGGACAGG + Intergenic
1124304299 15:28567056-28567078 GAATGCCTGAGAGGCAGGACAGG - Intergenic
1125758836 15:42083689-42083711 GACCAGCTTAGAACCAGGCCTGG - Intronic
1128399248 15:67260800-67260822 GAATGCCTTAGAACCAGGCCAGG + Intronic
1128727195 15:69997066-69997088 GAAGGACTTAGCACCGGGCCTGG - Intergenic
1129826517 15:78638260-78638282 GAATGCCTGAGAGGCAGGACAGG - Intronic
1133567787 16:7011221-7011243 AAAGCCCTTAGAACCAGCCCTGG - Intronic
1133702494 16:8322052-8322074 GAATGCCTTGGACCCATCCCAGG - Intergenic
1135302160 16:21339982-21340004 GAAGGCCTGAGAACCAGGGGAGG + Intergenic
1137907647 16:52339841-52339863 TAAAGCATTAGAACCATGCCTGG - Intergenic
1139366935 16:66439312-66439334 GAAAGCCTGAGTCCCAGGCCAGG + Intronic
1140866636 16:79067915-79067937 GAATGCCTGTGATCCAGGCAAGG + Intronic
1142845303 17:2670310-2670332 GAATGCATCAGAACCATGCACGG + Exonic
1143442637 17:6987303-6987325 AAATGCCTTAGGGCCAGGCATGG - Intronic
1144940851 17:18939278-18939300 GCAAGCATTAGAACCAGACCTGG + Intergenic
1145281835 17:21473646-21473668 GAAGACCTTAGAACAATGCCTGG - Intergenic
1145395612 17:22491973-22491995 GAAGACCTTAGAACAATGCCTGG + Intergenic
1146094518 17:29916245-29916267 GAGTGCATTAGCACCATGCCTGG - Intronic
1146495247 17:33316428-33316450 TAATGCCTTTGCACCACGCCAGG + Intronic
1147050952 17:37794495-37794517 TAATGCCTCAGGACCAGGACAGG + Intergenic
1147169456 17:38609461-38609483 GAAAGCCCCAGAAGCAGGCCTGG - Intergenic
1147603378 17:41759523-41759545 GAATTCCTGAGAATCAGGCTTGG - Intronic
1148748628 17:49932063-49932085 CAGTGCCTTAGCCCCAGGCCCGG + Intergenic
1150470308 17:65431571-65431593 GAAAACCAGAGAACCAGGCCTGG - Intergenic
1154358440 18:13640510-13640532 CAAAGCCTGAGAACCAAGCCTGG - Intronic
1155802327 18:30123278-30123300 AAATGCCTGAGAACCTGGCAGGG - Intergenic
1157914515 18:51651711-51651733 TAATGACTGAGAACCAGGCAAGG + Intergenic
1158296075 18:55998092-55998114 TACTGCCTTAAAACCAGCCCCGG - Intergenic
1159882636 18:73873804-73873826 TGATGTCTTAGAACCAGGCACGG - Intergenic
1161589456 19:5122704-5122726 GAATGCCTGAGGACCAGGAGGGG + Intronic
1163465924 19:17468730-17468752 AAATGCATTGGAATCAGGCCCGG + Intergenic
1165377166 19:35450799-35450821 GAAATCCTTAGACCCAGCCCAGG + Exonic
1166730405 19:45056160-45056182 GAGTGCCCAAGTACCAGGCCAGG + Intronic
927507300 2:23622792-23622814 AAAGGACTTAGAACCATGCCTGG - Intronic
931174101 2:59835526-59835548 GGAAGCCTTAGGACCTGGCCAGG + Intergenic
931407970 2:61999516-61999538 CAATGCCTTATAGCCAGGCTTGG - Intronic
931719066 2:65054433-65054455 CAATGCTGGAGAACCAGGCCTGG - Intergenic
932366585 2:71156999-71157021 GAATGCCTGAGAGGCAGGACAGG - Intergenic
935746119 2:106191847-106191869 GAATGCATGAGAACTATGCCAGG - Intronic
938108852 2:128551126-128551148 AAGTGCCCTAGAAGCAGGCCTGG + Intergenic
938141055 2:128794956-128794978 GAATCCCTGAGAACCATACCTGG - Intergenic
938736144 2:134188493-134188515 GAAGGTCTTAGAACCATGTCTGG + Intronic
946926462 2:224631878-224631900 GAAAGCCTTGGAGTCAGGCCGGG - Intergenic
948896375 2:240929797-240929819 GAACACCCCAGAACCAGGCCTGG - Intronic
1170466176 20:16624287-16624309 GAATGCCTGAGTTCAAGGCCTGG + Intergenic
1170505986 20:17026369-17026391 GAATTCCTTAGAGGCATGCCTGG + Intergenic
1171976331 20:31596997-31597019 TAATGCTTTAGAACCAGGCCTGG + Intergenic
1172299797 20:33841288-33841310 GAGTGCATTAGCTCCAGGCCAGG + Intronic
1172303270 20:33864357-33864379 CAGTGTCTCAGAACCAGGCCAGG - Intergenic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1173162669 20:40664114-40664136 GAAAGCCTCAGAAGCAGGGCGGG + Intergenic
1175200433 20:57273207-57273229 GAAGGCCAGAGAACCAGGCTTGG - Intergenic
1176302039 21:5103015-5103037 CAAGGCCTTAGAGACAGGCCTGG + Intergenic
1179854990 21:44158885-44158907 CAAGGCCTTAGAGACAGGCCTGG - Intergenic
1181978193 22:26747415-26747437 CAAGGCCTTAGAACAATGCCTGG - Intergenic
1184428389 22:44426589-44426611 TAAAGCCTTAGAGCCAGGCCTGG + Intergenic
1185140173 22:49095629-49095651 GGAAGCCGTGGAACCAGGCCTGG + Intergenic
950434537 3:12970863-12970885 GAAGGACATAGAACCAGCCCTGG - Intronic
952920425 3:38280235-38280257 CACTGCCTTAGCACCAGCCCAGG + Intergenic
953582215 3:44167469-44167491 CAATGCTTTAGACCCAGGCTGGG + Intergenic
954460986 3:50626821-50626843 GAATGGCTGAGAGCCAGGCCTGG - Intronic
957296136 3:78335302-78335324 GCAAGCATTAGAACCAGGCGTGG - Intergenic
958911224 3:99996367-99996389 GAATGGCTTTGACCAAGGCCTGG - Intronic
959577183 3:107946957-107946979 GAAGGCCTGAGAACCAGTCCAGG - Intergenic
959753398 3:109865646-109865668 GAAAGCATCAGAACCAGGCATGG + Intergenic
960303609 3:116034290-116034312 GATGGACTGAGAACCAGGCCTGG + Intronic
960961612 3:123074195-123074217 CAATGCCTTAGCATGAGGCCTGG - Intronic
961919980 3:130415426-130415448 GAAGGTCTTATATCCAGGCCGGG + Intronic
965194882 3:165580962-165580984 GAATGGCTTTGACCCAGGCATGG - Intergenic
965707653 3:171525318-171525340 GTGTGCATTAGATCCAGGCCTGG + Intergenic
966776097 3:183543866-183543888 TAAAGCCGTAGCACCAGGCCGGG + Intronic
968595120 4:1478192-1478214 GAAGGCCTGAGAATCAGGCCCGG - Intergenic
968767357 4:2479760-2479782 GAAAGCCTTAAAAGCAGGACGGG - Intronic
968788508 4:2642394-2642416 GAATGGCTAAGGAGCAGGCCAGG - Intronic
971363065 4:25954439-25954461 GAAGGCCTGAGAACCAGGAGGGG + Intergenic
971609212 4:28700491-28700513 GAATGATTAAGGACCAGGCCTGG + Intergenic
974991382 4:69094441-69094463 ATATGCCTTAGAAACCGGCCGGG - Intronic
975861760 4:78684913-78684935 GAATGTCTTAGAATCATGTCTGG + Intergenic
977597319 4:98897278-98897300 GAATGCCTTTGGGCCAGGCATGG + Intronic
977824390 4:101512909-101512931 AAATCCTTTAGTACCAGGCCTGG + Intronic
979474287 4:121136547-121136569 TAATGCTTTAAAAACAGGCCGGG + Intronic
985648249 5:1095207-1095229 GAAAGTCTTAGACCAAGGCCTGG - Intronic
985720745 5:1487342-1487364 GAATGACTCAGAACCACGCGTGG + Intronic
985768816 5:1796224-1796246 GAATTCTGCAGAACCAGGCCAGG - Intergenic
989726349 5:44591073-44591095 GAATGACTTAGCACCATCCCCGG + Intergenic
989777972 5:45232186-45232208 GGAAGCCTCAGAATCAGGCCAGG + Intergenic
990987528 5:61654783-61654805 GGATGCCTGAGGACCAGGGCAGG - Intronic
992025136 5:72662664-72662686 AAACGCCTTAGCACCAGCCCTGG + Intergenic
996889466 5:128401047-128401069 GAAGGCCTCAGAATCAGGGCAGG - Intronic
997213731 5:132093938-132093960 GAAAGCCCTTCAACCAGGCCAGG + Intergenic
997443560 5:133925716-133925738 GAGTGCATTAGACCTAGGCCTGG - Intergenic
997777879 5:136627764-136627786 GAAGGCCTGAGAACCAGGGAGGG - Intergenic
1000745130 5:165023475-165023497 GAATGCCTTAGAACTAGAGTTGG + Intergenic
1001879146 5:175228143-175228165 AAATGCCTTGGAACCTGTCCTGG + Intergenic
1001957006 5:175854536-175854558 CAAAGCCTTAGAACCGTGCCTGG + Intronic
1003325481 6:5086902-5086924 CAAGGCCTTAGAACCATGCCCGG - Exonic
1004033691 6:11900466-11900488 GGAAGCCTCAGAACCAGACCTGG - Intergenic
1007780373 6:44249546-44249568 GAATGCTTTAGTACCAGACTTGG - Exonic
1010422862 6:75693959-75693981 TAAAAACTTAGAACCAGGCCAGG + Intronic
1014235932 6:118954881-118954903 GAATGCCTTGGAGTCAGGCATGG + Intergenic
1014305195 6:119732444-119732466 GGAGGCCTCAGAACCAGGACAGG - Intergenic
1014771206 6:125459441-125459463 GAAGGCCTTAGAATCATGGCAGG + Intergenic
1016079685 6:139840550-139840572 GAAGGCCAGAGAACCAGGGCAGG - Intergenic
1018062515 6:160102035-160102057 GGGGGCCTTAGAAACAGGCCAGG - Intronic
1023774898 7:43596196-43596218 GATTTCCAGAGAACCAGGCCTGG - Intronic
1024082803 7:45869165-45869187 CAAGGCCTTAGAATGAGGCCAGG + Intergenic
1024161467 7:46680659-46680681 GAATCACTTAGAAGGAGGCCTGG + Intronic
1024231572 7:47367611-47367633 GGATGCCCCAAAACCAGGCCGGG - Intronic
1024348132 7:48334272-48334294 CAATACCTTGGCACCAGGCCTGG - Intronic
1026233372 7:68505040-68505062 GGAAGGCTGAGAACCAGGCCTGG - Intergenic
1029226587 7:99033265-99033287 GCATGTCCTAAAACCAGGCCTGG - Intronic
1031971214 7:128066329-128066351 GAATGCCTGGAAATCAGGCCTGG - Intronic
1032859200 7:135861593-135861615 GAAGGCCATAGAACCAGGTTTGG + Intergenic
1033728466 7:144147329-144147351 GCATGCCTCAGTGCCAGGCCAGG + Intergenic
1033866888 7:145700062-145700084 GACTGCCTTAGAGTCAGTCCAGG + Intergenic
1035890467 8:3337349-3337371 GCATCCCTTAGAAGCAAGCCAGG + Intronic
1036636003 8:10549847-10549869 GAAAGACTGAGAGCCAGGCCGGG - Intronic
1037653994 8:20867297-20867319 AAATGCCTAATAAACAGGCCTGG + Intergenic
1038027929 8:23608899-23608921 GAAGGCCTGAGAACCTGGCGGGG - Intergenic
1038141578 8:24850788-24850810 GCATGCCTTAGAAACTGGCTAGG - Intergenic
1040943502 8:52856716-52856738 AAAGGCCTGAGAACCAGGCAGGG + Intergenic
1046687066 8:117239438-117239460 GAAACCCTTAGCACCATGCCTGG + Intergenic
1049753252 8:144295850-144295872 GAATGCCTCAGGGCCAGGCGCGG - Intronic
1050880185 9:10689428-10689450 GAAAGCCTCAGAACAATGCCTGG + Intergenic
1055473232 9:76634678-76634700 GCATGACTTAGAACCAGGAGAGG - Intronic
1055481411 9:76712177-76712199 AAAACCCTTAGAACCATGCCTGG - Intronic
1055898077 9:81202413-81202435 TAATGCCTATGAACCATGCCTGG - Intergenic
1057615235 9:96583689-96583711 GAAATCCTCACAACCAGGCCAGG - Intronic
1059327447 9:113512764-113512786 GAATGCCTTAGAAGGGGCCCAGG + Intronic
1059396708 9:114038910-114038932 AAAAGTCTTAGAACAAGGCCTGG - Intronic
1060348931 9:122840520-122840542 GAATGGCTTAGCACCATCCCTGG - Intergenic
1062102074 9:134733623-134733645 GAAAACCTCAGAGCCAGGCCTGG + Intronic
1185913676 X:4010417-4010439 AAAGGCCTGAGAACCAGGCATGG + Intergenic
1186253715 X:7697591-7697613 GCATGCCTGAGCACCAGCCCTGG + Intergenic
1189354423 X:40300228-40300250 GAATGCACTGGAACCAGGCCTGG - Intergenic
1192576025 X:72243782-72243804 AAAGTCCTTAGAACAAGGCCTGG - Intronic
1196758139 X:119176058-119176080 GAATACCTCAGAATGAGGCCTGG + Intergenic
1197025551 X:121744632-121744654 GAATGCCTGAGAACCAGGGGAGG - Intergenic