ID: 1128401669

View in Genome Browser
Species Human (GRCh38)
Location 15:67288768-67288790
Sequence GGTACTCTTCTAAGCACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128401666_1128401669 14 Left 1128401666 15:67288731-67288753 CCATTTACATTCAAAGTTATTAC 0: 3
1: 71
2: 640
3: 4990
4: 8088
Right 1128401669 15:67288768-67288790 GGTACTCTTCTAAGCACTGGAGG 0: 1
1: 0
2: 7
3: 32
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128401669 Original CRISPR GGTACTCTTCTAAGCACTGG AGG Intronic
901117177 1:6856511-6856533 GGCACTATTCTAGTCACTGGGGG + Intronic
902992742 1:20200714-20200736 GGCACTGTTTTAGGCACTGGGGG - Intergenic
903574288 1:24328861-24328883 GGAACAGTGCTAAGCACTGGTGG + Intronic
904304687 1:29580462-29580484 GGTGCTCTACTGAGCACTGGGGG + Intergenic
905065959 1:35183093-35183115 GGTTCTCTTCTAAGAGCTAGTGG - Exonic
905193718 1:36257352-36257374 GGCACTATTCTAAACACTGGAGG - Intronic
905195374 1:36272242-36272264 GGTACTCTCCTAAAAAGTGGGGG - Intronic
906188326 1:43878871-43878893 GGCACAATTCTAAGTACTGGGGG + Intronic
907734790 1:57101708-57101730 GGCACTCTGCTAGGCACTGGGGG + Intronic
907987019 1:59542290-59542312 GGTACTGTGCTCAGCACTGCTGG - Intronic
908304772 1:62801433-62801455 GGCACTGTTCTAGGCACTGCAGG - Intronic
908344522 1:63218221-63218243 GGTACTGTACTAAGCTCTGGGGG - Intergenic
911177195 1:94828651-94828673 GTTACTCTTCTAGGCATTGTGGG + Intronic
911189175 1:94930795-94930817 GGAACTCTCATACGCACTGGTGG - Intergenic
913230427 1:116736460-116736482 GGTATTCTTCTAGGCCCTGGGGG - Intergenic
916459231 1:165005585-165005607 GGCACTGTTCTAGACACTGGAGG - Intergenic
916478272 1:165191044-165191066 GGCACTGTGCTAGGCACTGGGGG + Intergenic
917772048 1:178290189-178290211 GGAACTGTTCTAAGAACTGGTGG - Intronic
917904093 1:179572509-179572531 GGCACTATTCTAAGCCCTGGGGG - Intronic
918485151 1:185021051-185021073 GGAACTCTTCTAAACAGTTGAGG + Intergenic
919191677 1:194229754-194229776 GGTACTCTTTTAAATTCTGGAGG - Intergenic
919632401 1:199972034-199972056 GGCACTGTTCCAGGCACTGGGGG + Intergenic
919744534 1:201000286-201000308 GGTTCCCTCCTAAACACTGGTGG + Intronic
920283565 1:204862335-204862357 TGAAATGTTCTAAGCACTGGTGG + Intronic
921141392 1:212310387-212310409 GGTACTCTTAAAAACAGTGGAGG - Intronic
921940640 1:220835193-220835215 GGCACGCTTCTAAGCACTTCAGG - Intergenic
922587908 1:226749733-226749755 TATAATCTTCTAAGCAATGGAGG - Intergenic
1063557084 10:7091079-7091101 GGTACTTTCCTAGGCACTGTTGG + Intergenic
1063758328 10:9041705-9041727 GGTACTGGCCTAGGCACTGGGGG - Intergenic
1066648240 10:37632446-37632468 GGCACTGTGCTAAGTACTGGAGG - Intergenic
1069893590 10:71666817-71666839 TGCACTCTTGTAAGCTCTGGGGG - Intronic
1070345815 10:75540781-75540803 GGCACTCTTCTGAACACTAGGGG - Intronic
1072682850 10:97519050-97519072 GGCACTCTCCTAATCACTAGAGG + Intronic
1072729819 10:97838162-97838184 GGTACTGTTCTGGGCACTGGCGG - Intergenic
1073793952 10:106967724-106967746 TCTCCCCTTCTAAGCACTGGAGG - Intronic
1078545609 11:12245075-12245097 GGTATTATTCTCAGCACAGGAGG - Intronic
1078637434 11:13065220-13065242 GGCACTATTCTAAGCTCCGGGGG - Intergenic
1080600165 11:33814845-33814867 GGTCTTCTTCCAAGCACAGGTGG - Intergenic
1082677587 11:56126555-56126577 GGTACTGTTCTAGGTACTGGGGG - Intergenic
1082735697 11:56853336-56853358 GGCACTATTCTAGGCACTGAGGG - Intergenic
1083897405 11:65626944-65626966 GGTACTTCTCTACGCACTGCAGG - Exonic
1084311212 11:68317345-68317367 GGTACTCTTCAAAGGACAGCTGG - Intronic
1086331712 11:85761061-85761083 GGCACTATTCTAAGCACTGGAGG + Intronic
1087237504 11:95736420-95736442 GGCACCCTTCTAAGCACTCTGGG + Intergenic
1088192418 11:107240704-107240726 GCTATTCTCATAAGCACTGGCGG - Intergenic
1088335493 11:108699135-108699157 GGTCCTGTTCTAAGCACTTAGGG - Intronic
1090452621 11:126820080-126820102 GGCACTATTCTAAGTCCTGGGGG + Intronic
1090731755 11:129578562-129578584 GTCACTCTTCTCAGCACGGGTGG + Intergenic
1091033510 11:132212868-132212890 GCCTCTCTTCTAGGCACTGGGGG + Intronic
1092116674 12:6013823-6013845 GGTACTATTGTAAGCAATAGGGG + Intronic
1093700548 12:22215357-22215379 GGTGCTGTTCTATGCACTGAGGG + Intronic
1094270180 12:28605444-28605466 GGCCCTCTGCTAGGCACTGGAGG + Intergenic
1095885036 12:47179759-47179781 GGTACTCTTCTAGAGACTGAGGG + Intronic
1096000817 12:48128517-48128539 GGCACTATGCTAGGCACTGGGGG - Intronic
1099018000 12:77368452-77368474 GTTACTGTACTAAGCACTGCAGG - Intergenic
1100715820 12:97304044-97304066 GGGACTCTTCCAAGCTCTGAAGG - Intergenic
1101373482 12:104151387-104151409 GGCACTGTTCTAGGCACAGGGGG - Intergenic
1101761982 12:107666239-107666261 GGTGCTCCTCTGTGCACTGGAGG + Intergenic
1102469406 12:113151128-113151150 GGCACCCTTGTAGGCACTGGGGG - Intronic
1102707402 12:114894133-114894155 GGCACTGTTCTTGGCACTGGTGG - Intergenic
1104089859 12:125507285-125507307 GGTACTTTCCTAGGCACTGGGGG + Intronic
1104641683 12:130471207-130471229 CGCCCTCTTCAAAGCACTGGCGG + Intronic
1105320746 13:19319161-19319183 GGCACTTTTCTAGGCACTGAGGG + Intergenic
1105342550 13:19541046-19541068 TGTCCTCTTCTAAGCTCAGGTGG + Intergenic
1105601960 13:21895450-21895472 GGTGCTATTTTAAGCACTGATGG + Intergenic
1106139547 13:27000792-27000814 GGCCCTGTGCTAAGCACTGGGGG + Intergenic
1109377321 13:61513585-61513607 GGAACTCTACTAAGCACTGATGG + Intergenic
1109936243 13:69288722-69288744 GGCACTCTTTTAAGCACTTGGGG - Intergenic
1110650953 13:77940171-77940193 GGTGCTATTCTAGGCACTGGGGG + Intergenic
1111907436 13:94271650-94271672 GGTACTGTTCTAATCACTTTAGG - Intronic
1116444764 14:44996152-44996174 GGTGCTTTTCTAAGTCCTGGAGG + Intronic
1121241919 14:92437132-92437154 GGTTTTGCTCTAAGCACTGGGGG - Intronic
1121878498 14:97477505-97477527 GCTACTTTTCTCAGCACTGGTGG + Intergenic
1125270543 15:37934216-37934238 GGCTCTGTTCTAAGCACTGGAGG - Intronic
1126936709 15:53717704-53717726 GGTACTGTTCTATGCATTGTAGG - Intronic
1127044301 15:55009918-55009940 GATGCTCTTCTAGGCACTTGAGG - Intergenic
1128401669 15:67288768-67288790 GGTACTCTTCTAAGCACTGGAGG + Intronic
1131224803 15:90615617-90615639 GGAATTCTTCGAAGCACTGAAGG - Intronic
1134805430 16:17120133-17120155 GGCACTATGCTAGGCACTGGAGG - Intronic
1135042372 16:19127735-19127757 GGTACTCTACTGAGCACTGCAGG - Intronic
1135723280 16:24834801-24834823 GGCAGTGTTCTAAGCTCTGGGGG - Intergenic
1138749763 16:59405131-59405153 GGTAGTCTTGCAAGCACTGCTGG + Intergenic
1139342063 16:66273977-66273999 AGTACTGTGCTAGGCACTGGGGG - Intergenic
1140208551 16:72952825-72952847 CGTACGCTTCTAGGAACTGGAGG - Intronic
1141020651 16:80493003-80493025 GGTACTGTTCTAGGCTCTAGAGG - Intergenic
1141068203 16:80931030-80931052 GGCACTGTTCTAAGTACTAGGGG + Intergenic
1141394098 16:83689845-83689867 GGTGCTTTTCTAGGCATTGGGGG + Intronic
1141648368 16:85379338-85379360 GGCACCATTCTAGGCACTGGGGG - Intergenic
1142684237 17:1568435-1568457 GGCACGATTCTAGGCACTGGGGG + Intergenic
1149522252 17:57326331-57326353 GGTGCTGTTCCAAGCCCTGGGGG + Intronic
1150469088 17:65420900-65420922 GGGACTGTTCTAAGGACTGCTGG - Intergenic
1153687917 18:7565436-7565458 GGCACTGTGCTAAGTACTGGAGG - Intergenic
1155404452 18:25472704-25472726 GGCACTCTTCTAGACACTGAAGG - Intergenic
1156681718 18:39597734-39597756 AGTACTCTTCTAATAACTGAGGG + Intergenic
1157412399 18:47474222-47474244 GACACTTTGCTAAGCACTGGAGG - Intergenic
1160581228 18:79885633-79885655 GGCACTGTCCTAACCACTGGTGG - Intronic
1161510307 19:4666937-4666959 GGTCCTCTTCCAAGCTCTTGTGG + Intronic
1161873379 19:6887873-6887895 GGTGCTGTTCTAGGCACTAGAGG + Intronic
1161939143 19:7391800-7391822 GGTGGTCTCCTATGCACTGGAGG - Intronic
1164910034 19:32002612-32002634 GGTCCTCTTCCAAGCCCAGGTGG + Intergenic
1165132908 19:33644329-33644351 GGTACTGTTCTAGGCACTGGGGG + Intronic
1166965263 19:46526108-46526130 GGCACTGTCCTAGGCACTGGGGG - Intronic
925629470 2:5875395-5875417 GGTGCTCTTCTAAGCTCATGTGG + Intergenic
926674029 2:15604661-15604683 GGTACCCTGGTAAGTACTGGAGG + Intronic
929261076 2:39867175-39867197 GGTTCATTTCTAAGCACAGGTGG - Intergenic
929315616 2:40474549-40474571 GGTACTATTCTCAGAAATGGTGG + Intronic
929641785 2:43587809-43587831 AGCACTCTTCTAGGAACTGGGGG - Intronic
929882733 2:45851349-45851371 GTTACTCTTCTCAGAACTGGGGG + Intronic
930887860 2:56348621-56348643 CGTACCCTTCTCAGCACTTGTGG - Intronic
931944394 2:67288781-67288803 GATACTATTCTAGGCACTGGGGG + Intergenic
932144726 2:69307196-69307218 GGCACTTTTCTAGGCCCTGGGGG - Intergenic
932221751 2:70004919-70004941 GGCACTATTCTAAACACTGGGGG - Intergenic
933676596 2:85063014-85063036 GGCACTGTTCTAGGCACTTGGGG + Intergenic
935080691 2:99790675-99790697 GGGACTCTCCTATGCACTGTAGG - Intronic
937033751 2:118763683-118763705 GGGACTCTTGTATTCACTGGGGG - Intergenic
937115584 2:119402838-119402860 GGTGCTTTTCTAAGCACCAGAGG + Intergenic
937682408 2:124658035-124658057 GGTACTATTCTAAGCATTTTGGG - Intronic
939283989 2:140105034-140105056 TGTATTCTTCTATTCACTGGTGG - Intergenic
939527627 2:143317199-143317221 GGTACTCTTATAGGCACTGGGGG - Intronic
940091838 2:149928489-149928511 AGTACTCTTCTAGGCATTTGGGG + Intergenic
941751702 2:169141454-169141476 GGCACTGTTCTAAGTGCTGGAGG - Intronic
942452736 2:176118273-176118295 GGCCCACCTCTAAGCACTGGGGG - Intronic
943526117 2:189019766-189019788 AGTACTCTTCTAAACACTATAGG + Intergenic
945598497 2:211827294-211827316 AGAGCTCTTCTAAGCACTGTTGG + Intronic
1168896421 20:1326804-1326826 GGCACTGTGCTCAGCACTGGGGG - Intronic
1169317830 20:4608125-4608147 GACACTGTTCTAAGCACTTGGGG - Intergenic
1169557000 20:6761965-6761987 GGTTCTCTTCCATGCTCTGGTGG - Intergenic
1171749860 20:29038439-29038461 TGTACTCTTCAAAGCAATAGGGG - Intergenic
1172403609 20:34671198-34671220 GGTATTGTTCTAAGCACTTTAGG - Intronic
1173954235 20:47018350-47018372 GGCACCCTTCTAGGCACTGAGGG + Intronic
1176725088 21:10425003-10425025 GGAACTGTGCTTAGCACTGGTGG - Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1181766981 22:25099228-25099250 GGTACCCTTCTTACCAGTGGTGG - Intronic
1181810431 22:25400702-25400724 GGTACTCTTCAAAGGACAGCTGG + Intronic
1182899201 22:33884014-33884036 GGCACTGTTCTAAGTACTGTGGG - Intronic
1183591614 22:38782432-38782454 GGCACTGTTCTAGGCACTGTGGG - Intronic
1183765140 22:39866324-39866346 GGAAGTATTCTAAGCAATGGGGG + Intronic
1184357030 22:43989097-43989119 GGTAGTCTCCTAAGCAAAGGAGG - Exonic
949421895 3:3874662-3874684 GGTATTTTTCTAGGCACTGGTGG - Intronic
949777382 3:7648048-7648070 GGGCCTCTACTGAGCACTGGGGG - Intronic
950900225 3:16490952-16490974 GGCACTGTCCTAAGCACTGAGGG + Intronic
951633831 3:24751322-24751344 TGCACTCTGCTAGGCACTGGGGG + Intergenic
952974985 3:38686152-38686174 GCTACTCATCTGAGAACTGGCGG + Intergenic
954092397 3:48295449-48295471 GGGACTCTTCTAACCACCAGAGG + Intronic
955154455 3:56402918-56402940 GGGACTCTTCTCAGCACTGTGGG + Intronic
955399148 3:58578947-58578969 GGCACTGTTCTAAGTGCTGGGGG + Intronic
955689034 3:61572616-61572638 GGTGCTGTTCTAGGCACTGGGGG + Intronic
956935666 3:74098490-74098512 GGTACTCTTCTAAGTGCTGAGGG + Intergenic
958899705 3:99871410-99871432 GGTACTTTCCTAGGCACTGGAGG + Intronic
959480877 3:106871361-106871383 GTCACTCTAGTAAGCACTGGTGG + Intergenic
959803753 3:110526641-110526663 AGTACTCTTCTGAGCAATGAAGG - Intergenic
961930851 3:130531239-130531261 GGAACTCTTCTGTGCACTGCAGG + Intergenic
966671653 3:182533573-182533595 GGAACTGTACTAAGCATTGGGGG - Intergenic
967109848 3:186283671-186283693 GGCACTCTTCTAAGCACTGAGGG - Intronic
969856484 4:10003865-10003887 TGTACTATTCTAAGAACTGGAGG + Intronic
971076442 4:23154422-23154444 GGCACTGTTCTAATCACTGGAGG - Intergenic
972766404 4:42155687-42155709 GGTACCTTTCTAAGCACTGGGGG + Intergenic
974463051 4:62214648-62214670 GGTACTCTTATAAGGAATAGAGG + Intergenic
976097008 4:81518879-81518901 GGTACTCTTCCAAGGGCTGGTGG - Intronic
976570435 4:86601902-86601924 GACACTCTACTAGGCACTGGTGG + Intronic
977857443 4:101910838-101910860 GGTACTCTTCTAGATACTGAAGG + Intronic
978152622 4:105455128-105455150 GGCACTGTTCTAGGCACTGTGGG - Intronic
979571918 4:122237422-122237444 GGCATTATTCTAGGCACTGGAGG + Intronic
980485811 4:133456463-133456485 GGTCTTCTTCAAAGCACCGGTGG + Intergenic
980839010 4:138234154-138234176 GACACTGTTCTAAACACTGGAGG - Intronic
980894600 4:138850192-138850214 GATACCCTTATAAGCAGTGGGGG + Intergenic
986776195 5:11016443-11016465 TGTATTTTTCTAAGCAATGGGGG - Intronic
987020056 5:13861026-13861048 TGTACTCTTCTAGGCGCTGTGGG - Intronic
988702846 5:33692499-33692521 GGAACTATTCTAAGTGCTGGGGG - Intronic
988962934 5:36387654-36387676 GGTACCCTTGTATGCACTGTTGG - Intergenic
989997779 5:50856007-50856029 GGTACTGTGCTAGGCACTGGGGG + Intergenic
993270842 5:85793766-85793788 GGAACTCTTTTACGCATTGGAGG - Intergenic
995712267 5:115047740-115047762 GGTACTCTTCTCCCCACTGCCGG - Intergenic
997270063 5:132528979-132529001 GGCACTGTTCTAAGTATTGGTGG - Intergenic
997330322 5:133055603-133055625 GCCATTTTTCTAAGCACTGGAGG + Intronic
1000995283 5:167952515-167952537 GGCACTCTGCAAACCACTGGAGG - Intronic
1002160030 5:177309614-177309636 GGCCCTATTCTAGGCACTGGGGG - Intronic
1002964550 6:1950490-1950512 AGGACTCTTCTAATCATTGGAGG - Intronic
1003822152 6:9910728-9910750 GGTAATATTCTAGGCACTGTGGG - Intronic
1003846225 6:10176493-10176515 GGTACTAATCTAAACAGTGGAGG + Intronic
1005229194 6:23680767-23680789 GTTACTCTACTAAACACTGTAGG + Intergenic
1006728129 6:36214696-36214718 GGCACTGTTCTAGGCATTGGGGG + Intronic
1007382833 6:41501940-41501962 GACACTGTTCTAGGCACTGGGGG - Intergenic
1007413588 6:41679167-41679189 GCTGCTCATCTAAGCAATGGAGG - Intergenic
1009409985 6:63355316-63355338 GGCACTGTTCTAAGTACTTGGGG + Intergenic
1010570329 6:77466451-77466473 GGGACTCTGCGAAGCAGTGGAGG - Intergenic
1013617632 6:111859518-111859540 GGAACTTTTCTATGAACTGGAGG - Intronic
1014402856 6:121012671-121012693 GGCACTCTTCTGGGCACTGGGGG - Intergenic
1015136274 6:129875076-129875098 TGTACACTTCTAAACACTGAAGG + Intergenic
1015593193 6:134842169-134842191 GGTACTGTTCTAAGCACCGGGGG - Intergenic
1019501240 7:1365752-1365774 GGCACTGTTCTAGGCACTGGGGG + Intergenic
1019781339 7:2941972-2941994 GGCACTGTGCTAAGCACTGTGGG - Intronic
1020255192 7:6498983-6499005 GATGCTATTCTAAGCCCTGGAGG - Intronic
1020592796 7:10164135-10164157 GGCATTCATCTAAGCACTGGGGG + Intergenic
1022547939 7:31206570-31206592 CCAACTCTTCTAAGCTCTGGAGG - Intergenic
1022765819 7:33410119-33410141 GTTACTGTTCTGTGCACTGGTGG - Intronic
1023124399 7:36940777-36940799 GGCTCTCTGCTAGGCACTGGGGG + Intronic
1025083460 7:56004061-56004083 GGGCCTCTCCTAATCACTGGAGG - Intergenic
1030978775 7:116161719-116161741 GGCACTGTTCTAAGCATTAGAGG + Intergenic
1033217181 7:139501546-139501568 GGTACTGTGCTCAGCACTTGGGG + Intergenic
1033842318 7:145389714-145389736 GGGTCTCTTCTAATCACTGAAGG - Intergenic
1034612713 7:152386419-152386441 GGAACTGTGCTTAGCACTGGTGG + Intronic
1035487342 7:159236346-159236368 GCTCCTGTTCTAAGCTCTGGTGG - Intergenic
1036612688 8:10363609-10363631 GGCACAGTTCTCAGCACTGGGGG - Intronic
1039508076 8:38066707-38066729 GGCACTGTTTTAAGCACTAGGGG + Intergenic
1043771405 8:84206187-84206209 ATTATTCTTCTAAGCACTGTGGG + Intronic
1045259272 8:100558036-100558058 GGCTCTGTTCTAAGCACTGGGGG - Intronic
1048235637 8:132687330-132687352 GGCACTCTTCTAAGCACTTGGGG + Intronic
1049491926 8:142909501-142909523 GGAACACTTCTAAATACTGGTGG + Intronic
1051937753 9:22465196-22465218 GGCATTCTTCTGTGCACTGGGGG + Intergenic
1055837010 9:80455576-80455598 GTGACTCATCTAAGGACTGGTGG + Intergenic
1055981357 9:82005629-82005651 GGAACTGTTCTAAACACAGGAGG - Intergenic
1058111987 9:101040848-101040870 GGTACTCTTCTAGGTCTTGGAGG - Intronic
1186850036 X:13570659-13570681 GGCACTGTTCTAAGCACTTCAGG + Intronic
1187418002 X:19110140-19110162 AATACTATTCTAGGCACTGGGGG + Intronic
1187863905 X:23706666-23706688 GGTCCTCTCCTCAGCGCTGGGGG + Exonic
1188411527 X:29877963-29877985 GATACTCTTGTAAACACTGTGGG - Intronic
1189711163 X:43813760-43813782 GGCACTGTTCTGGGCACTGGAGG + Intronic
1190014368 X:46814084-46814106 AGTACTGTTCTGGGCACTGGGGG - Intergenic
1190266326 X:48829309-48829331 GGTCCTCCACGAAGCACTGGTGG - Exonic
1190461573 X:50681781-50681803 GGTACTATTTTAGGAACTGGGGG - Intronic
1191784890 X:64906626-64906648 GGTACTCTTCCAGGCACTTTTGG + Intergenic
1191964119 X:66737986-66738008 GATTTTCTTCTAAGAACTGGAGG - Intergenic
1192192391 X:68999319-68999341 GATACTGTTGTAGGCACTGGAGG - Intergenic
1193207205 X:78763002-78763024 GACATTCTTCTAGGCACTGGGGG + Intergenic
1196188072 X:112765531-112765553 GGCACTCTTCTGGGCTCTGGAGG + Intergenic
1196573809 X:117295119-117295141 AGTACTCTTATAGGCCCTGGAGG + Intergenic
1196887476 X:120261889-120261911 AGTACTGTTCTGAGCTCTGGAGG - Intronic
1201376606 Y:13329817-13329839 GCTACTGTTTTAAGCAATGGGGG - Intronic
1201978505 Y:19880803-19880825 GGTACAGATGTAAGCACTGGTGG - Intergenic
1202589791 Y:26470621-26470643 TGTCCTCTTCTAAGCTCAGGTGG - Intergenic