ID: 1128404118

View in Genome Browser
Species Human (GRCh38)
Location 15:67317643-67317665
Sequence CTCTTGTTAGATCTCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128404115_1128404118 9 Left 1128404115 15:67317611-67317633 CCTTGAATTGAAAAGGGACTTCG 0: 1
1: 0
2: 0
3: 33
4: 157
Right 1128404118 15:67317643-67317665 CTCTTGTTAGATCTCCTGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128404118 Original CRISPR CTCTTGTTAGATCTCCTGGA AGG Intronic
903031722 1:20468425-20468447 ATCTTGTAAGATTTCCTGCAGGG + Intergenic
903952482 1:27004439-27004461 CTCTAATCAGATCCCCTGGATGG - Intergenic
904652489 1:32015877-32015899 CTCTGGTAAGATCACATGGAAGG + Intronic
904833417 1:33320135-33320157 CTCCTGTCTGAGCTCCTGGAGGG + Intronic
905140662 1:35841317-35841339 CTCTTGGGAGATCTCCTGCCGGG - Exonic
905411976 1:37776817-37776839 CTTCTGCTACATCTCCTGGAAGG - Intergenic
907883459 1:58572454-58572476 CTCTTGTTAGAACTAGAGGAAGG - Intergenic
908797433 1:67845065-67845087 GTCTTGTTAGCTGTGCTGGAGGG + Intergenic
911436871 1:97871453-97871475 CTCTTGTGTGAGCTCCTGCAGGG - Intronic
911871113 1:103100571-103100593 CTCTTTTTATTTCTCCTTGAAGG + Intronic
918413658 1:184286045-184286067 CTCTTATTATATCTCCTGTAAGG - Intergenic
921019804 1:211225359-211225381 CTATTGTTAGATCATCTGGTTGG - Intergenic
1064199868 10:13275202-13275224 CCTTTGTTAGGTGTCCTGGAAGG - Intergenic
1067858459 10:49819042-49819064 CTCTTGTGAAATCCCATGGAAGG - Intronic
1068348082 10:55810260-55810282 CTGATGTCAGATCGCCTGGATGG + Intergenic
1069614653 10:69799389-69799411 CTGTTTTTAAAGCTCCTGGAAGG + Intergenic
1071324979 10:84505321-84505343 CTTTTCTTAGATTTCCTGGAAGG + Intronic
1078501298 11:11880964-11880986 GTCTTGTCAGATCTCTTTGAGGG + Intronic
1081140893 11:39498441-39498463 CAATTGTTAGTTCTCCTGCAAGG + Intergenic
1081387346 11:42487375-42487397 CTCTTTTTAAAACTCCTGGATGG - Intergenic
1082955019 11:58861128-58861150 CTCTTGTTCGATTTCTTGGAAGG + Intronic
1086983908 11:93227631-93227653 CCCTTGAGAGTTCTCCTGGAGGG - Intergenic
1087033666 11:93733481-93733503 CTATTGTTAGATCTGTGGGAAGG - Intronic
1092190325 12:6514894-6514916 ATTTTGCTAGATCACCTGGATGG + Exonic
1092919771 12:13221103-13221125 TACTTGTCAGAGCTCCTGGAAGG + Intergenic
1092966515 12:13648846-13648868 TTATTGTTACATCTCCTTGAGGG + Intronic
1097201727 12:57284567-57284589 CTCTTCTTGCAACTCCTGGAAGG - Intronic
1097493676 12:60301114-60301136 CTCTTGTTAGCTGTCAAGGAAGG - Intergenic
1108799883 13:54082084-54082106 CTCTTGTTGCATGTCCTGCAAGG + Intergenic
1109852125 13:68079167-68079189 TCCTTATTTGATCTCCTGGAAGG + Intergenic
1118736077 14:68702821-68702843 CCCTGGGTAGATCTCCTGGCTGG - Intronic
1120205879 14:81587158-81587180 TTCTTGTTTGATTTGCTGGATGG + Intergenic
1124880571 15:33638867-33638889 CTCTTGTTACATCCCCTGTCAGG - Intronic
1125140355 15:36399110-36399132 CCCTTGTTAGATTTACTGGTGGG + Intergenic
1128404118 15:67317643-67317665 CTCTTGTTAGATCTCCTGGAAGG + Intronic
1128468771 15:67934557-67934579 CTTTTATTAGATCGCCAGGAAGG - Intergenic
1135269197 16:21054338-21054360 CTCATCTCAGTTCTCCTGGACGG - Intronic
1135752969 16:25071553-25071575 CTTTTGCTTGAGCTCCTGGATGG + Intergenic
1138432020 16:56975129-56975151 CTCTTGGAAGATTTCCTGGTTGG - Exonic
1143111958 17:4558009-4558031 ATCCTGTTAGAACCCCTGGAAGG + Exonic
1146150229 17:30462133-30462155 CTCTTGTTAGAAATCTTGAAGGG + Intronic
1155624548 18:27819557-27819579 TTCTTGTTGCATCCCCTGGAGGG + Intergenic
1158079306 18:53569891-53569913 CTCATGTTAGATATCATGGGGGG + Intergenic
1158554352 18:58463078-58463100 CTCTTGTTTAATCTTCTGTAAGG + Intergenic
1159752683 18:72322449-72322471 CTCCTGTTAGAGCTTCTGAAAGG + Intergenic
1161097753 19:2403029-2403051 CTCATGCTACATCTCCTGGTTGG - Intronic
1165153645 19:33774840-33774862 TGCTTCTCAGATCTCCTGGATGG - Intergenic
1165741338 19:38206933-38206955 CTCTATTTGGATCTCCAGGACGG + Exonic
1166914640 19:46186657-46186679 TTCTTGTAATATCTTCTGGAAGG - Intergenic
929330485 2:40675305-40675327 CTGTTGTTAGATCATCTGGCTGG - Intergenic
931612091 2:64112562-64112584 CTCTGCTTAGATCTCTTAGAAGG + Intronic
932504247 2:72213566-72213588 CTCTTGTTAGAACTTCAGGATGG + Intronic
938278081 2:130045357-130045379 CTCCTTTGATATCTCCTGGAGGG + Intergenic
938329051 2:130436158-130436180 CTCCTTTGATATCTCCTGGAGGG + Intergenic
938360893 2:130685334-130685356 CTCCTTTGATATCTCCTGGAGGG - Intergenic
938437299 2:131292028-131292050 CTCCTTTGATATCTCCTGGAGGG - Intronic
939164762 2:138628537-138628559 CTGTTGTTAAATATCATGGAGGG + Intergenic
941213612 2:162676313-162676335 CTCTTGGTAAATCTCATTGACGG + Intronic
943400116 2:187398162-187398184 TCCATATTAGATCTCCTGGAGGG - Intronic
944423001 2:199551032-199551054 TTCTTGTAAGATTTCCTGGCCGG + Intergenic
945815084 2:214595787-214595809 CTTTTGTTATATCTCATGCAAGG - Intergenic
1172280252 20:33702967-33702989 CTCCTCTCAGATCTGCTGGAAGG + Exonic
1174774087 20:53327547-53327569 CCCTTGTTACATCACTTGGAAGG - Intronic
1175614051 20:60377555-60377577 CTTTTGTGAGATGTCCTAGAGGG + Intergenic
1177193391 21:17876605-17876627 CTCTTATTAGCTATCCTGGGGGG - Intergenic
1177647464 21:23917797-23917819 CTCTTGTTCGGCATCCTGGAAGG - Intergenic
1181977289 22:26739202-26739224 CTCTTGATAGAGCCCCTGAAGGG + Intergenic
1182000742 22:26917561-26917583 CTCTTTTAAGTTCTTCTGGAAGG + Intergenic
1185399989 22:50610712-50610734 CTCTTGGTAGTACTCCAGGAAGG - Exonic
952257842 3:31710811-31710833 CTCTTATCAGAGCTCCAGGAAGG - Intronic
952957582 3:38566559-38566581 CTCTAGGTAGATGTCCTCGAAGG + Exonic
955790358 3:62582706-62582728 CTCTTGGTGTATCTCCTGGCAGG + Intronic
957954205 3:87162654-87162676 CTCTTTTTATATCTGCTGAATGG - Intergenic
960489608 3:118298185-118298207 CTCTTGCTATTTCTCCTGGGTGG - Intergenic
961545894 3:127632783-127632805 CTCTTGTTGCACCTCCAGGAAGG + Intronic
962696068 3:137948484-137948506 CTCTTTCTAGCTCTCCTTGATGG - Intergenic
963253606 3:143122279-143122301 CACCTGTTTGATCTGCTGGAAGG - Exonic
963697772 3:148583502-148583524 CTCTTGTTAAAGCTGATGGAAGG - Intergenic
964555870 3:157937734-157937756 CTCTTGATAGATTTCCAGGAGGG - Intergenic
965139296 3:164814642-164814664 CTGTTGTTGGATCATCTGGAAGG - Intergenic
967934016 3:194712064-194712086 GTCTTCTTAGTTCTCATGGAAGG + Intergenic
970676834 4:18460259-18460281 CTCTTGTTACAGCTGTTGGATGG + Intergenic
970705667 4:18798861-18798883 CTCTTCTTACCTCTCCTGGGTGG + Intergenic
979412705 4:120398120-120398142 CTCTTTTTATCTCTCCTGAAGGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
982061649 4:151610365-151610387 CTCTTCTTAGATCCACTAGATGG - Intronic
982061853 4:151612745-151612767 CTCTTCTTAGATCCACTAGATGG - Intronic
984960994 4:185098689-185098711 CTCTTGTTAGCTATCCCAGAGGG - Intergenic
984982474 4:185296064-185296086 TTCTTATTACATCTCCTGGAGGG + Intronic
987274927 5:16352369-16352391 CTCTTGACAGAGCCCCTGGATGG + Intergenic
988214495 5:28253486-28253508 GTTTTGTCAAATCTCCTGGACGG + Intergenic
995361141 5:111298887-111298909 CTCTCATTAGATCCCCTGCAGGG - Intronic
995682298 5:114733248-114733270 CTCTTGATGGCTCTGCTGGATGG + Intergenic
999446199 5:151641506-151641528 CTCCTCTCAGGTCTCCTGGAAGG - Intergenic
1001791189 5:174459223-174459245 CTCCTCTGAGCTCTCCTGGATGG + Intergenic
1002695729 5:181087099-181087121 CTATTGTTAAATCTGCTGTATGG + Intergenic
1003607403 6:7575765-7575787 CTCTTGTTATGACTCTTGGAAGG + Intronic
1006614011 6:35312492-35312514 CTCCTGGTAGACCTCGTGGATGG - Exonic
1012045651 6:94269565-94269587 CTCTTTTAAAATCACCTGGAAGG - Intergenic
1019282972 7:209914-209936 CTCTGGACAGATGTCCTGGAGGG + Intronic
1026053731 7:66967443-66967465 CTCTTCCTAGCCCTCCTGGAGGG + Intergenic
1027649241 7:80845048-80845070 CTCTTGTTGAATCTCCAGCAGGG + Intronic
1032709291 7:134448244-134448266 CTCTTGCTGGTTTTCCTGGAAGG - Intronic
1033058423 7:138081452-138081474 CCCTTATGAGATCTCCTGGCTGG - Intronic
1035880245 8:3238734-3238756 CTCTAATTAGATGTCCTGGGTGG - Intronic
1041208397 8:55522165-55522187 CTCTTGTTCCACCTCCTGTATGG - Intronic
1041241065 8:55849541-55849563 CACTTATCTGATCTCCTGGAAGG + Intergenic
1042079229 8:65031869-65031891 CTCTCGTTAAATTTCTTGGATGG - Intergenic
1045393893 8:101741380-101741402 CTCTTCTTAGATCACCTCTATGG - Intronic
1046132479 8:109983946-109983968 ATATTGTTAGATTTCCTTGACGG + Intergenic
1049993290 9:1010315-1010337 CTTTTGTGAGATCTTCAGGAAGG - Intergenic
1057907456 9:98993724-98993746 CCCTTTTAACATCTCCTGGAAGG + Intronic
1186707662 X:12159150-12159172 CTCTTGTAAGGTCTCCTCCAAGG + Intronic
1187499470 X:19827565-19827587 TTCTTCTGAGTTCTCCTGGAAGG - Intronic
1188025256 X:25201592-25201614 CTCTTGCCAGGTCTCCTTGATGG - Intergenic
1188377783 X:29454100-29454122 CTTTTGTTTGATGCCCTGGAGGG + Intronic
1194051936 X:89079874-89079896 CACATGTTAAATCTCCTGGTGGG - Intergenic
1199955691 X:152740581-152740603 CCCTTCTTTGATCTCCTGGTTGG + Intergenic