ID: 1128405861

View in Genome Browser
Species Human (GRCh38)
Location 15:67337862-67337884
Sequence GACCCAAAGCTGGTTCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128405858_1128405861 5 Left 1128405858 15:67337834-67337856 CCTTCTATCTGTTGTCTGGAATT 0: 1
1: 0
2: 4
3: 46
4: 635
Right 1128405861 15:67337862-67337884 GACCCAAAGCTGGTTCCCAAAGG 0: 1
1: 0
2: 1
3: 5
4: 117
1128405856_1128405861 15 Left 1128405856 15:67337824-67337846 CCTTATCTCGCCTTCTATCTGTT 0: 1
1: 0
2: 0
3: 17
4: 267
Right 1128405861 15:67337862-67337884 GACCCAAAGCTGGTTCCCAAAGG 0: 1
1: 0
2: 1
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128405861 Original CRISPR GACCCAAAGCTGGTTCCCAA AGG Intronic
900406227 1:2494213-2494235 ACCCCAAAGCTCATTCCCAATGG - Intronic
902689897 1:18104625-18104647 TACCCCAACCTGGCTCCCAAGGG - Intergenic
902957941 1:19939459-19939481 GATCCAAGGGTGGGTCCCAAAGG - Intergenic
903289236 1:22297375-22297397 GACCCGAAGCTGGAACACAATGG + Intergenic
904120464 1:28194421-28194443 GACCCAAAGCTGCTTTCAGAAGG + Intergenic
906679913 1:47719523-47719545 AACCCAGAGCTCATTCCCAATGG - Intergenic
910856883 1:91704735-91704757 AACCCAACACTGATTCCCAAGGG + Intronic
918248184 1:182679164-182679186 CACCCAAGGGTGTTTCCCAAGGG - Intronic
922586982 1:226740970-226740992 GACCCTAATTTGGTTCCCTAGGG + Intergenic
1062971395 10:1651853-1651875 GACCCAGGGTTGGTTCCCAGTGG + Intronic
1065269879 10:24017778-24017800 GACCCAGACCTGGGTTCCAAAGG + Intronic
1069622335 10:69845610-69845632 CACCTGAAGCTGGTTCCCATTGG - Intronic
1070288732 10:75101124-75101146 GACCCACAGCTGTTCCCCACTGG - Intronic
1072481628 10:95814604-95814626 CACCCAAAGCTGAGTCTCAAGGG + Intronic
1073182470 10:101593140-101593162 GACTCAAGGCTGGATGCCAAGGG + Intronic
1075960594 10:126564335-126564357 GACTCTAACCTGGGTCCCAAAGG + Intronic
1080237122 11:30083764-30083786 GACCCAAAGCTAATTATCAAGGG + Intergenic
1081612093 11:44568797-44568819 GACCCAAACCTGTTCCCCTAAGG + Intronic
1084489466 11:69470721-69470743 GACCCAAATCTCTTTCCCACGGG - Intergenic
1089332765 11:117701413-117701435 GACCATAAGCGGGTTCTCAAAGG - Intronic
1091063549 11:132487633-132487655 AACCCCAAGCTGGGTCCTAACGG - Intronic
1095252210 12:39992003-39992025 GCCCCAAAGCTGATTTACAAAGG + Intronic
1101116278 12:101534668-101534690 GTACCAAAGGAGGTTCCCAAGGG + Intergenic
1103023639 12:117556363-117556385 GACCCAAGGCAGGGTCTCAAGGG + Intronic
1107137052 13:36956645-36956667 GACCCAAAGGAGGTTGCCCAAGG - Intronic
1110555162 13:76851605-76851627 GTCCCAGAGATGGGTCCCAAGGG - Intergenic
1112300010 13:98221455-98221477 AAGCCAAAGCTGTGTCCCAAGGG + Intronic
1119203855 14:72779442-72779464 GAACCCAAGATGGCTCCCAATGG + Intronic
1124617394 15:31251493-31251515 GACCCAGAGCTGGCTCCCAGAGG + Intergenic
1127268061 15:57376807-57376829 GCCCCGAAGCGGGTTCCCCAGGG - Intronic
1128405861 15:67337862-67337884 GACCCAAAGCTGGTTCCCAAAGG + Intronic
1128725815 15:69987868-69987890 AACCCAAAGCTCCTTCCCCAGGG + Intergenic
1129989179 15:79947336-79947358 GACTTAAAGTTGCTTCCCAAAGG + Intergenic
1131116665 15:89800113-89800135 GAGATAAAGCTGGTCCCCAAGGG - Intronic
1131391336 15:92051325-92051347 GTCCCAAAGCTGTTCCCTAAGGG - Intronic
1139385491 16:66566436-66566458 GACGCGACGCTGGTTCCCAGGGG + Exonic
1139937211 16:70579968-70579990 GACCCCAAGCAGGTGCCTAAGGG - Exonic
1141540524 16:84717037-84717059 GACCCGCAGCTGATTCTCAACGG - Intronic
1142198185 16:88748455-88748477 GACCCCAAGGTGGTTCCCAAGGG + Intronic
1142790807 17:2264176-2264198 GACCACAAGCTGGATCCTAAGGG + Intronic
1142863050 17:2775181-2775203 GACCCAGAGCAGGATCACAATGG - Intergenic
1142979994 17:3666175-3666197 GACCTAAAGAAGTTTCCCAAAGG + Intronic
1143373136 17:6452814-6452836 GAACCAGAGCTGTTTCCAAAAGG + Exonic
1143644096 17:8218572-8218594 GACCCAAACCTTGTTCCTGAAGG - Intergenic
1148143627 17:45345688-45345710 AACAAAAAGCTGGTTCCCCACGG - Intergenic
1148580150 17:48738146-48738168 GACTCAAAGCTTGGTCACAAGGG + Intergenic
1148644325 17:49210586-49210608 GACCCAAACCTGCTTGCAAAGGG - Exonic
1148670240 17:49404730-49404752 GACCTAAAGCTGGTTTGCATAGG + Exonic
1151334984 17:73434443-73434465 GCCCCAAAGGTGGCTACCAAGGG - Intronic
1155995999 18:32332151-32332173 GAGCCAAAACTGTATCCCAAAGG - Intronic
1156908445 18:42382093-42382115 GACCCAAACCTAGAGCCCAAAGG - Intergenic
1158758405 18:60354081-60354103 AGCCAAAAGCTAGTTCCCAAGGG - Intergenic
1160445986 18:78927170-78927192 GGCACCAAGCTGGTTCCCCACGG - Intergenic
1162662620 19:12182225-12182247 GACACAAAGCTTTTTCACAATGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1167508128 19:49881873-49881895 GGCCCACAGCTGGATCCCAGGGG - Intronic
1167540153 19:50081024-50081046 GACCCAGGGCTGGTTACCCATGG - Intergenic
1167629549 19:50616774-50616796 GACCCAGGGCTGGTTACCCATGG + Intergenic
926048624 2:9728608-9728630 GAGCCAGAGCTGGTTCTTAATGG - Intergenic
927202663 2:20588076-20588098 CACCCCAAGCTGGTCACCAAGGG + Intronic
932721394 2:74141254-74141276 AACACAAAGATGGATCCCAAAGG + Intronic
934761529 2:96859497-96859519 AAGCCAAGGCTGGCTCCCAAGGG + Intergenic
935406132 2:102711498-102711520 GCCACACAGCTGGTACCCAAAGG - Intergenic
935963343 2:108448814-108448836 GACCCACAGCTGGTTCCGGGGGG - Exonic
940027350 2:149222298-149222320 GAGCCAAAGCTTGCTCCCTAAGG - Intergenic
945491706 2:210463595-210463617 GACTGAATGTTGGTTCCCAAGGG - Intronic
945731738 2:213545931-213545953 GACCCAAAGCTGATTAGCAGAGG + Intronic
947396120 2:229688474-229688496 AACCCAAAGATGGTTCCAAGAGG - Intronic
948037708 2:234872773-234872795 GACCCAACCTTGGTTCTCAAAGG + Intergenic
1169288034 20:4325941-4325963 GACCCACAGCTCGGTCCCTAGGG + Intergenic
1173665201 20:44758043-44758065 GCCCCAAGGCTGGTTTCAAATGG - Intronic
1174725417 20:52856625-52856647 GACCCTATGTTGGTTTCCAATGG + Intergenic
1175490347 20:59376303-59376325 GCCCCACAGCTGACTCCCAAGGG + Intergenic
1179292721 21:40032684-40032706 GTCAAAGAGCTGGTTCCCAAAGG - Intronic
1184564128 22:45281552-45281574 AACCCAAAGTTGCTTCACAATGG - Intergenic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
949822042 3:8126020-8126042 GACCAAAAACTGGTGCCAAAAGG - Intergenic
949953005 3:9244809-9244831 GACCCCATGCTGGTGCCAAATGG - Intronic
950355520 3:12405044-12405066 AACCCAAAGTGTGTTCCCAAAGG + Intronic
950759121 3:15205151-15205173 GGCCCAAAGATGGCTCTCAAAGG - Intergenic
951491844 3:23279618-23279640 GACCCTAAGCTGGTTCCAACTGG - Intronic
952132707 3:30383823-30383845 GACCCAGTGCTGGTTTCCACAGG - Intergenic
958667680 3:97161236-97161258 GGCCAAAAGCTGTTTCTCAAAGG + Intronic
960244821 3:115388602-115388624 AAACCAAAGCTGGTTTCCAGTGG - Intergenic
966605237 3:181814949-181814971 GAGCCATGGCAGGTTCCCAAAGG + Intergenic
969963772 4:10973597-10973619 GGCCCCTAGCTGGTGCCCAAAGG + Intergenic
970688189 4:18591806-18591828 GACCCAGGCCTGGTTCACAATGG + Intergenic
972169830 4:36332500-36332522 GCCCTAAAGCTGGTCCACAATGG + Intronic
975113845 4:70657226-70657248 TACACAAATCTGGTTCTCAATGG + Exonic
986940901 5:12947998-12948020 AACCCAACCCTGGTTCCCATGGG - Intergenic
987153450 5:15063547-15063569 GACCCAAACCTTATTCCTAAAGG - Intergenic
995358016 5:111261802-111261824 GAGCCTAAACTGGTTCACAAGGG - Intronic
1000551619 5:162672999-162673021 GATCCAAAGTTAGTTCCCAAAGG - Intergenic
1003060028 6:2855712-2855734 GACCCAATGCTGGGGCCCTAAGG - Intergenic
1003927272 6:10887849-10887871 GTCCCAAATCTGTTTCCCCATGG - Intronic
1005941373 6:30562715-30562737 GAAGCAAAGATGGGTCCCAAAGG - Exonic
1006505002 6:34483468-34483490 GACCCAACTCTGGTGCCCACCGG - Intronic
1011396641 6:86917043-86917065 GACCTAAAAATGGATCCCAAAGG - Intergenic
1014149656 6:118040033-118040055 GACCCAAAGCAGCATACCAAAGG - Intronic
1017588884 6:155957081-155957103 GACCCTAAGCTGGAGCTCAAGGG + Intergenic
1017641992 6:156503424-156503446 CACCCAAATCTAGTTTCCAAGGG - Intergenic
1018304682 6:162442806-162442828 TGCCCAAAGCTAGTTGCCAATGG + Intronic
1018775680 6:167013115-167013137 CACACAAAGCTGGTTCCTAAAGG - Intronic
1019750032 7:2723539-2723561 GTCCGACAGCTGGCTCCCAAGGG - Intronic
1030819739 7:114081829-114081851 GGCCCATAGCTGATTCCAAAGGG + Intergenic
1035053625 7:156019060-156019082 GACCAAGACCTGGTTCCAAATGG - Intergenic
1037214813 8:16436596-16436618 CACCCAAAGCTGGGATCCAAAGG - Intronic
1038246475 8:25861083-25861105 GACCCCAAGCTGGCTGCCATAGG + Exonic
1038398887 8:27267985-27268007 ATCCCAAACCTGGTTCCAAAGGG + Intergenic
1041773949 8:61503596-61503618 GTCCCAAAGGTTGTTACCAAAGG - Intronic
1045778120 8:105830768-105830790 GAAAGAAAGCTGTTTCCCAATGG + Intergenic
1050134931 9:2452610-2452632 GAGCTAAAGTTGGTTCCCACTGG - Intergenic
1055720527 9:79168075-79168097 GACCCTAACCTGGTTCTCATTGG - Intergenic
1055721988 9:79185175-79185197 GAGCCGAAGCTGGTTACCAGAGG - Intergenic
1057700799 9:97361954-97361976 GCCCCAAAGCTGGTCCCTGAAGG - Intronic
1059667586 9:116463365-116463387 CTCCCTAAGCTGGTTCACAAAGG + Intronic
1060638697 9:125220614-125220636 GACATATAGCTGGTTTCCAATGG - Exonic
1061025854 9:128048946-128048968 GACCCAGAGCTGGCCCACAAGGG - Intergenic
1061444498 9:130630271-130630293 GCCCCACAGCTGGCCCCCAAGGG + Intronic
1062146938 9:134994715-134994737 GGGCCACACCTGGTTCCCAAGGG - Intergenic
1187432397 X:19237100-19237122 GAGCCTTAGCTGCTTCCCAAAGG + Intergenic
1191936769 X:66435348-66435370 GACCCTGAGCTGGTTTCCTAAGG - Intergenic
1199698256 X:150359036-150359058 GACCCAAACCTGGAGCTCAATGG - Intergenic
1199776366 X:151015414-151015436 GGGACAAAGCGGGTTCCCAAGGG - Intergenic