ID: 1128407029

View in Genome Browser
Species Human (GRCh38)
Location 15:67352784-67352806
Sequence TTATCCTGCTTTGTATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 412}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128407029 Original CRISPR TTATCCTGCTTTGTATTTAT TGG Intronic
901713261 1:11132661-11132683 TTAACTTTCTTTGTTTTTATTGG - Intronic
902453124 1:16511539-16511561 TTTTCCTGCTTTATAAATATAGG - Intergenic
902499361 1:16898689-16898711 TTTTCCTGCTTTATAAATATAGG + Intronic
903082632 1:20823141-20823163 TTATCCTGTATTGCATATATGGG + Intronic
903823916 1:26128385-26128407 TTGTCCTGTTTTTTATTTGTCGG + Intergenic
904372115 1:30055581-30055603 TTATCCTACTTTGAATTTGTTGG - Intergenic
904951448 1:34243192-34243214 TTATCCTGTTCCGAATTTATGGG + Intergenic
905992449 1:42350410-42350432 TTATCCTGTATTGTCTGTATTGG - Intergenic
908239896 1:62180056-62180078 TTATCTTGCTTTTCAGTTATGGG - Intergenic
908284943 1:62586282-62586304 TTATTCATCTTTGTATTTCTAGG + Intronic
909799782 1:79792039-79792061 TTATCCTCCTTTGTTGCTATTGG + Intergenic
911790517 1:102010378-102010400 TTAACCTGCTTTTTTTTTATAGG - Intergenic
912122816 1:106493456-106493478 TTACCCTGCTTTGTATTAAACGG + Intergenic
917462289 1:175242418-175242440 TTTGCCTGCTTTATATTCATTGG - Intergenic
918744547 1:188182992-188183014 TTATTCAGGTTAGTATTTATTGG + Intergenic
919197775 1:194311067-194311089 TTCTCCTTCTTTATATTTTTTGG + Intergenic
920578994 1:207087158-207087180 TTAACCAGTTTTGTATCTATTGG + Intronic
921628597 1:217405593-217405615 TTGTCCTCCTTAATATTTATGGG + Intergenic
922077237 1:222258036-222258058 TTATCCAACTTTGTATTCCTGGG - Intergenic
922202794 1:223420540-223420562 CTATCCTGCTTTGTAAATCTTGG + Intergenic
923631764 1:235653981-235654003 TTATGCTGCTTGGTGTTCATTGG + Intergenic
924649271 1:245909137-245909159 TAATCATGCTTTGAATTTCTGGG - Intronic
1063468392 10:6263621-6263643 TTGTCCTGCATTGTAATTCTGGG - Intergenic
1064853693 10:19740248-19740270 TTTCCCTGGTTTTTATTTATAGG - Intronic
1065698700 10:28403874-28403896 TTTTCCAGCTTTGAAATTATGGG + Intergenic
1065968304 10:30786030-30786052 TCCTGCTGCTTTGTTTTTATTGG + Intergenic
1066792555 10:39081834-39081856 TTATCTTGCTTTTCAGTTATAGG - Intergenic
1066794869 10:39108569-39108591 TTTTCCTGATTTTCATTTATTGG - Intergenic
1067679381 10:48419248-48419270 TTTTCCTTTTTTGTATTAATCGG + Intronic
1067784288 10:49231801-49231823 TTCTCATGCTGTGTATTTGTGGG - Intergenic
1067980267 10:51076084-51076106 TTATCTCTATTTGTATTTATTGG + Intronic
1069398954 10:68021094-68021116 TTATCCTGCGTAGAATTCATTGG - Intronic
1069852324 10:71417409-71417431 TTATCCTACTTTGTATCCTTAGG + Intronic
1070211196 10:74323985-74324007 TTATCCAGTTTTGTTTCTATAGG + Intronic
1070671908 10:78383655-78383677 GTACCCTACTTTGTTTTTATAGG + Intergenic
1071033132 10:81208010-81208032 TTAGCCTGATTGGGATTTATTGG - Intergenic
1071808238 10:89147891-89147913 TTTTCCTGATTTTTATTTTTTGG + Intergenic
1072600803 10:96926227-96926249 TTATCTTGGTTTGCATTTTTTGG + Intronic
1073864147 10:107783159-107783181 TTATCCTTCTTAATTTTTATTGG + Intergenic
1074658174 10:115618728-115618750 TTTCCCTGATTTCTATTTATTGG + Intronic
1075208238 10:120465466-120465488 TTCTGCTGCTTTGTCTTTAGTGG - Intronic
1076826094 10:132970317-132970339 TTATTCTGCTTTGGATTTGCTGG + Intergenic
1076940915 10:133607725-133607747 TTATCTTGCTTTGCAGTTATGGG + Intergenic
1077728539 11:4702776-4702798 TTATCCTGCTTTCAATTCTTTGG - Intergenic
1078121290 11:8512254-8512276 TTTTCATAGTTTGTATTTATTGG + Intronic
1078733353 11:13996789-13996811 ATATCCTGTTTTATTTTTATGGG + Intronic
1079113168 11:17618865-17618887 TTCTCCAGCTTTGTTTTGATTGG + Intronic
1079283883 11:19111790-19111812 CTATCATAGTTTGTATTTATTGG - Intergenic
1079720424 11:23804976-23804998 TTCCTCTGCTTTGGATTTATAGG - Intergenic
1082862637 11:57870504-57870526 ATATCCTGCTTCATATTTATTGG - Intergenic
1082913149 11:58400118-58400140 TCATCCTGCTATGTAGGTATAGG + Intergenic
1083703638 11:64498230-64498252 TTATCCTACTTGGTATTTTCGGG - Intergenic
1085117406 11:73941976-73941998 TTACCTTGCTTTGCAGTTATGGG - Intergenic
1086179627 11:83935057-83935079 TTATCCTGCTATGGTTTTCTTGG + Intronic
1086905880 11:92417455-92417477 TTACACTACTTTGTATTTATTGG - Intronic
1086997961 11:93380366-93380388 TCATCCTGCTCTGTTTTTTTGGG + Intronic
1087070675 11:94077071-94077093 TTATCTCTCTTTGTTTTTATGGG + Intronic
1087108983 11:94442210-94442232 TTAGCCTGCTTAGCAATTATTGG - Intronic
1087522713 11:99262718-99262740 TTATTCTGCTTTGTTTTTAAGGG + Intronic
1087533587 11:99415143-99415165 TTAACCTCCTTTTTGTTTATAGG - Intronic
1088186182 11:107174290-107174312 ATATCATGCTTTGTATTTTGTGG - Intergenic
1088207097 11:107404700-107404722 GTATACTGTTTTGTATTGATAGG + Intronic
1088292364 11:108254336-108254358 TTTCCCTCCTTTGTATTTAGAGG - Intronic
1089068798 11:115682599-115682621 TTATCCTGGTTTGTTTGGATGGG + Intergenic
1090393340 11:126403630-126403652 TCATCTTCCTTTGTATTCATAGG - Intronic
1090553396 11:127847856-127847878 TTAACATGCTATATATTTATTGG - Intergenic
1090597753 11:128337252-128337274 TTATCCTGCTAACTATTTAGTGG - Intergenic
1091420199 12:331754-331776 CTAAGCTGCTTTATATTTATAGG + Intronic
1091861709 12:3791395-3791417 TCATCCTGCTTTGTAATACTGGG + Intronic
1093254312 12:16846958-16846980 TTATCTTTCTTACTATTTATTGG - Intergenic
1094092327 12:26663802-26663824 TTCTCCTGCTTTCTCTTTAAAGG + Exonic
1094197440 12:27764208-27764230 AAATACTGCTTTGTCTTTATAGG + Intronic
1095276497 12:40290370-40290392 TTATACTTCCTTGTAATTATGGG + Intronic
1096139403 12:49230267-49230289 TTAACCATATTTGTATTTATGGG + Intronic
1096759431 12:53828064-53828086 TTATATTTCTTTGTATTTAGGGG + Intergenic
1097332209 12:58343708-58343730 CTATCCAGCATTGTATTTCTTGG - Intergenic
1098961880 12:76747261-76747283 TTTTGCTGCTTTTTATTCATAGG - Intergenic
1099056432 12:77847295-77847317 TTTTCCTTCTCTGTTTTTATTGG + Intronic
1099197528 12:79635549-79635571 TTCTCCTGCTTTGTTTTTATAGG - Intronic
1100034600 12:90235515-90235537 GTATCCTTCTTTGTAATTAAAGG + Intergenic
1100770497 12:97916516-97916538 TTATCCTGCTTGGAATTCATTGG - Intergenic
1100909992 12:99348457-99348479 TTATCTTACTTGGTATTTGTTGG - Intronic
1100914012 12:99397612-99397634 TTTTCCAGCTTTGTCATTATGGG + Intronic
1101299779 12:103467304-103467326 ATATCCTTCATTGTATTAATGGG + Intronic
1102446659 12:113008243-113008265 TTATCCTGCAGGGTTTTTATTGG + Intronic
1102851715 12:116252881-116252903 TTAACCTGAGTTTTATTTATTGG - Intronic
1103243459 12:119434662-119434684 TCACCCTGCTATGTCTTTATTGG - Intronic
1103315286 12:120049582-120049604 TTCTTCTGCTTTGTTTTCATTGG + Intronic
1104124224 12:125830184-125830206 TTATTCTGCTTTGTATGAAAAGG - Intergenic
1104387481 12:128363930-128363952 TTCTCCTGGGTTGTAGTTATTGG - Intronic
1105076485 13:16033010-16033032 TTCTTCTGCCTTGTATTTATGGG - Intergenic
1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG + Intronic
1107907997 13:45079308-45079330 TCAACCTAGTTTGTATTTATTGG + Intergenic
1108752103 13:53458329-53458351 TTATCCTAAATTGCATTTATTGG - Intergenic
1109881110 13:68477736-68477758 TAATCATGCTTTGTATTTGCAGG + Intergenic
1110169059 13:72478681-72478703 TTATGATCCTTTGTATTTCTGGG - Intergenic
1110404297 13:75132273-75132295 TTATCTTTCTTTCTACTTATGGG - Intergenic
1110453777 13:75667258-75667280 TTATTCTGCTTGGTATTTGCTGG + Intronic
1110681724 13:78321769-78321791 TTTTCTTGCATTGCATTTATGGG + Intergenic
1110970456 13:81754542-81754564 CTAACCTGCTTTGATTTTATAGG + Intergenic
1111001075 13:82183003-82183025 CTATTCTGCTTTCTATTTTTAGG + Intergenic
1111033516 13:82638734-82638756 TTTTCCAGCTTTTTATTTGTTGG - Intergenic
1111098132 13:83541116-83541138 TGATCCTGCATTGTAATTAAAGG - Intergenic
1112180494 13:97074367-97074389 ATATCTTGCTTTGGATTCATTGG + Intergenic
1112633844 13:101192984-101193006 TTATCCTGGACTTTATTTATTGG - Intronic
1112877098 13:104056250-104056272 TTATAATGCTTTGTATTTTCTGG + Intergenic
1114234190 14:20810512-20810534 TTATCCTACTTTATCTTCATGGG - Intergenic
1114283886 14:21221585-21221607 CCATCCTGCTCTGTAGTTATAGG - Intronic
1116167941 14:41358058-41358080 TTATCTACCTTTGTTTTTATAGG + Intergenic
1116232723 14:42237850-42237872 TTATCCTTCTTTGCTTTTTTTGG + Intergenic
1117512566 14:56468527-56468549 TTATCCTGCATTCTGTTGATAGG - Intergenic
1118080502 14:62353558-62353580 TTATCCTTCATTCTGTTTATGGG + Intergenic
1118200402 14:63666294-63666316 TTAACCTTTTTTTTATTTATGGG - Intergenic
1120303336 14:82735868-82735890 TTAACCAGCTTTGAATTGATGGG + Intergenic
1121297623 14:92842384-92842406 TTATACTGCTTTTTATTTATAGG + Intergenic
1121730190 14:96181370-96181392 TCATCATGGTGTGTATTTATGGG - Intergenic
1122495335 14:102150072-102150094 TTATCTTGCTTTGTATCAATAGG + Intronic
1123667948 15:22624086-22624108 TTTTCCTTCTTGTTATTTATTGG - Intergenic
1124323000 15:28729964-28729986 TTTTCCTTCTTGTTATTTATTGG - Intronic
1124523920 15:30430525-30430547 TTTTCCTTCTTGTTATTTATTGG - Intergenic
1124534746 15:30535690-30535712 TTTTCCTTCTTGTTATTTATTGG + Intergenic
1124763903 15:32471917-32471939 TTTTCCTTCTTGTTATTTATTGG - Intergenic
1124774724 15:32577137-32577159 TTTTCCTTCTTGTTATTTATTGG + Intergenic
1126891335 15:53207592-53207614 TTAAACTACTTTATATTTATTGG + Intergenic
1127768821 15:62213829-62213851 TTATCTTGCTTTTCAGTTATGGG - Intergenic
1128407029 15:67352784-67352806 TTATCCTGCTTTGTATTTATTGG + Intronic
1128829768 15:70756872-70756894 TTATCCTTCATTTTATTTTTTGG - Intronic
1129863112 15:78878895-78878917 TTATACTGTTTTGTATTTTACGG - Intronic
1130713409 15:86307141-86307163 TTATTCTAATTTGTATTTTTGGG + Intronic
1136650446 16:31665192-31665214 TTCTCTTGCTTTGCAGTTATGGG + Intergenic
1137306843 16:47209349-47209371 TTATGCTTCTTTGCTTTTATTGG - Intronic
1137522284 16:49204631-49204653 TTATACTGCTTTTTATGCATAGG - Intergenic
1138325747 16:56165879-56165901 TTACCCTGCTTTCTTTATATGGG + Intergenic
1140025101 16:71281183-71281205 TTATCCAGCTTTTTTTTTAAAGG + Intergenic
1141371643 16:83492385-83492407 TTATCTTGCTTTGTTTTGGTGGG + Intronic
1144071643 17:11678728-11678750 TTATTCTGCTTGGGATTTGTTGG + Intronic
1144443785 17:15308013-15308035 TCCTCCTGCTGTGTATATATAGG + Intronic
1147272305 17:39283068-39283090 TTATAATGCTTTGTGTTTGTTGG - Intronic
1150736797 17:67747392-67747414 TTAGCCTTCTTTGTAATTGTTGG + Intergenic
1151409681 17:73913885-73913907 TTATCCAGCTTTTTCTTGATAGG - Intergenic
1151413249 17:73944949-73944971 ATTTTCTGCTTTGTATTTAATGG + Intergenic
1152601886 17:81266868-81266890 TAGTCCTGCTTTTTATTTTTTGG - Intronic
1153867315 18:9284210-9284232 TTATTGTGCTTTGTACATATTGG - Exonic
1153871365 18:9323364-9323386 TCATCCTATTTTGTAATTATAGG + Intergenic
1154088086 18:11327021-11327043 TTATCCTGCATTGTCTGCATGGG + Intergenic
1156417090 18:36907582-36907604 TTAACCAGCTTTGCATTTCTGGG + Intronic
1156554429 18:38050994-38051016 TTATCCTGCATTTCTTTTATGGG + Intergenic
1156703731 18:39855355-39855377 GTTTCCTGCTTTGTATTCAATGG - Intergenic
1156810799 18:41248430-41248452 TTATCCTGCTTGGAATTTATAGG - Intergenic
1156917493 18:42478784-42478806 TGATCATCCTTTATATTTATTGG - Intergenic
1157038771 18:44011724-44011746 TTATCCTGCGTGGTTTTCATTGG + Intergenic
1157981488 18:52386674-52386696 TTATCCTGCTGTGTATTACTTGG - Intronic
1158161514 18:54489904-54489926 GTATTATGCTTTGTATTTTTAGG - Intergenic
1158238611 18:55350298-55350320 TTGTTCTGTTTTGTATTGATGGG - Intronic
1159409008 18:68045272-68045294 TTAACCAGCTTTGTATATTTTGG + Intergenic
1159592897 18:70354151-70354173 TTATCCTGCTTGGGGTTTGTTGG - Intergenic
1159600943 18:70428137-70428159 TCATCCTGCTTTTCATTTAAAGG + Intergenic
1161573515 19:5043178-5043200 TTATCCCGCGTGGTGTTTATTGG + Intronic
1161573523 19:5043216-5043238 TTATCCCACTCTGTGTTTATCGG + Intronic
1161573548 19:5043331-5043353 TTATCCTGCGCAGCATTTATCGG + Intronic
1161573557 19:5043370-5043392 TTATCCCGCGTGGTGTTTATCGG + Intronic
1161573569 19:5043409-5043431 GTATCCTGCGTGGTGTTTATCGG + Intronic
1161573575 19:5043447-5043469 TTATCCCGCGCTGTGTTTATCGG + Intronic
1161573618 19:5043640-5043662 ATATCCTGCGTGGTGTTTATCGG + Intronic
1161573627 19:5043679-5043701 GTATCCTGCGTGGTGTTTATCGG + Intronic
1161573632 19:5043717-5043739 ATATCCTGCGTGGTGTTTATCGG + Intronic
1161573657 19:5043832-5043854 TTATCCCACTCTGTGTTTATCGG + Intronic
1161573675 19:5043909-5043931 TTATCCCGCGTGGTGTTTATCGG + Intronic
1161573695 19:5043987-5044009 TTATCCCGCGTGGTGTTTATCGG + Intronic
1161573714 19:5044064-5044086 TTATCCCGCGTGGTGTTTATCGG + Intronic
1161573724 19:5044103-5044125 TTATCCCGCGTGGTGTTTATCGG + Intronic
1161573752 19:5044218-5044240 TTATCCCGCGTGGTGTTTATCGG + Intronic
1161573761 19:5044256-5044278 TTATCCCGCGTGGTGTTTATCGG + Intronic
1161573780 19:5044333-5044355 TTATCCCGCGTGGTGTTTATCGG + Intronic
1161573789 19:5044371-5044393 TTATCCCGCGTGGTGTTTATCGG + Intronic
1162008790 19:7798459-7798481 TTAACCTGATTTTTATTTATAGG + Intergenic
1163941990 19:20503603-20503625 TATTCTTGCTTTGTAGTTATGGG - Intergenic
1202705364 1_KI270713v1_random:19268-19290 TTTTCCTGCTTTATAAATATAGG - Intergenic
925705447 2:6680699-6680721 TTATCATGTTTTGTAATTACAGG - Intergenic
925942711 2:8836204-8836226 TTCTCCTGCTTTTTTTTTTTTGG - Intronic
926259183 2:11241503-11241525 TTACCTTGCTTGGTATTTATTGG - Intronic
926760582 2:16275369-16275391 TTCTCCTGCTTTGGAATTCTGGG - Intergenic
927534493 2:23843847-23843869 GTATCCTTTTATGTATTTATGGG - Intronic
927574201 2:24187937-24187959 TTATCCTACTTGGAATTCATGGG + Intronic
928924115 2:36559463-36559485 TTATCCTGTTTTTCAGTTATGGG - Intronic
930334782 2:50031384-50031406 TTATCTTGCTTATTACTTATGGG + Intronic
930991369 2:57659788-57659810 TTTTCCTTCTTTGTGTTCATGGG + Intergenic
931976351 2:67648119-67648141 TTATTCTGCTATGTAATTACTGG - Intergenic
932015893 2:68025901-68025923 TTATCTTGTTTTGGATTTGTAGG + Intergenic
932277723 2:70463929-70463951 TCATCGTGCTTTGTATTAACAGG + Intronic
932550988 2:72768788-72768810 TCATCATGCTTTGGGTTTATAGG - Intronic
933204256 2:79487085-79487107 TTAAACTGCTTTGGAATTATAGG - Intronic
933535084 2:83561939-83561961 TTAGCTTCCTTTGTTTTTATGGG + Intergenic
934981083 2:98842038-98842060 TTATCCTTCTTGGGATTCATTGG + Intronic
935592956 2:104857279-104857301 TTATTATGCTTTTTATTTTTTGG - Exonic
937041531 2:118824423-118824445 TTATCTTGCTGTGTCTTTCTCGG - Intergenic
937141208 2:119602603-119602625 TTAGGCTGCTTTGAATTTTTAGG - Intronic
938286595 2:130123158-130123180 ATATCCTGGTTTGCATTGATAGG - Intronic
938429002 2:131215704-131215726 ATATCCTGGTTTGCATTGATAGG + Intronic
939235743 2:139490039-139490061 TTATCCTGCTTTTTTTTTTGTGG + Intergenic
939613229 2:144334093-144334115 TTAACCTACATTGTGTTTATTGG - Intergenic
939855582 2:147354841-147354863 TTTTCCTGCTTTGTATGTGGGGG - Intergenic
940146458 2:150550272-150550294 TTATCTTGCTTCTTATGTATAGG - Intergenic
940596618 2:155801636-155801658 TTATTGTGCTTTGGATTTCTTGG - Intergenic
943011880 2:182460138-182460160 TTATGCAGATTTGTATTTTTAGG - Intronic
943055408 2:182971617-182971639 TCCTCCTGCTTTGTACTTTTTGG - Intronic
943348342 2:186768202-186768224 TTATCCTTTTTTGTATTTTATGG - Intergenic
943802273 2:192076169-192076191 TTTTCCAACTTAGTATTTATAGG + Intronic
944779366 2:203002392-203002414 TTGTTCAGCTTTTTATTTATTGG - Intronic
945022102 2:205584297-205584319 TTATCATACTTTGGATATATTGG + Intronic
945329000 2:208517288-208517310 TTATCCTTTTTTGTGCTTATTGG + Intronic
945790185 2:214294746-214294768 ATAACCTGCTTTATGTTTATAGG + Intronic
947508799 2:230731943-230731965 TTATCCTGCACTGATTTTATTGG + Intronic
948682960 2:239648778-239648800 TCATCCTGCTTTGTTGCTATAGG - Intergenic
1169485044 20:6022749-6022771 TTATTCTGCTTGGGATTTATTGG + Intronic
1170187910 20:13612441-13612463 TTATCATGTTTTGTCTTGATAGG - Intronic
1170287774 20:14730281-14730303 TTTTCCTGCTTGGGATTTGTTGG - Intronic
1173563750 20:44024662-44024684 TTTTACTTCTTTGTATTTGTTGG - Intronic
1176324288 21:5373598-5373620 TCCTTCTGCCTTGTATTTATGGG - Intergenic
1177719323 21:24883973-24883995 TTCTCCTGCAATGTATTTAGTGG + Intergenic
1178071476 21:28972815-28972837 GTATCCTGCTTGGGATTTGTTGG - Intronic
1178905997 21:36637110-36637132 TTTTCCTCTTTTGTATTTGTGGG + Intergenic
1180035109 21:45243564-45243586 TTCTCCTCCTTTGGATGTATTGG + Intergenic
1180400758 22:12420278-12420300 TCCTTCTGCCTTGTATTTATGGG - Intergenic
1181379415 22:22488635-22488657 CTATCAAGATTTGTATTTATAGG + Exonic
1181848811 22:25734972-25734994 TTATCCTTCCTTGCATTTTTGGG - Intergenic
950916743 3:16653724-16653746 TTATCATGATTTCTATATATTGG + Intronic
950973847 3:17218893-17218915 TTATCCTGCTTGGAGTTAATTGG + Intronic
951133561 3:19076744-19076766 TTATCCTATTTTGTATTAAAGGG + Intergenic
951856171 3:27199714-27199736 TTATCCAGCCTAGAATTTATGGG - Intronic
952667542 3:35924616-35924638 TTAACCTAATTTATATTTATCGG - Intergenic
953306555 3:41836030-41836052 GTATCCTGCTTTTTACATATAGG - Intronic
953619074 3:44517222-44517244 TTATCCTGTTTAGGATTTACTGG - Intergenic
954735538 3:52704539-52704561 TTCTCATGCTCTGTATTTCTTGG - Intronic
955195147 3:56798720-56798742 TTATCTGTTTTTGTATTTATTGG - Intronic
956140275 3:66139391-66139413 GTATCTTGCTTTCTTTTTATTGG - Intronic
956325664 3:68049891-68049913 TTATCCTGCTTTGTAGAGAAAGG + Intronic
956874821 3:73452029-73452051 ATAACCTGCTATGTCTTTATGGG + Intronic
957369569 3:79275353-79275375 TTATCCTGCATTCTGTTGATAGG - Intronic
957550684 3:81699684-81699706 TTCTCCTGCTTTATATTCACTGG + Intronic
957971832 3:87391696-87391718 TTATTCTTCTTTGTCTTCATTGG - Intergenic
959373843 3:105563309-105563331 TTATCTTTCTTAGTCTTTATAGG + Intronic
959486174 3:106929230-106929252 TTTTCTTGTTTTGTATTTAACGG + Intergenic
960060892 3:113319314-113319336 TTATCCTTCTTAATTTTTATTGG - Intronic
960240942 3:115341367-115341389 TCATCCTGCTTTTTTTTTCTTGG - Intergenic
960897853 3:122524266-122524288 TTATACTGTTTTCTATTTTTTGG + Intergenic
961611113 3:128140418-128140440 TTATCCACCTTTCTAATTATTGG + Intronic
963182481 3:142373389-142373411 TTTTCCTGCTTTCTATTTCTGGG - Intronic
963182860 3:142378671-142378693 TTTTCCTGCTTTCTATTTCTGGG - Intronic
963337352 3:143990908-143990930 TTATCCTACCTTTTATTCATGGG + Exonic
964188167 3:153971986-153972008 TTAACCTTCTTTATATTTTTTGG - Intergenic
964313655 3:155420588-155420610 TTCTTCTGCTATGTTTTTATTGG - Intronic
964643958 3:158937920-158937942 TTATCCTTTTTTGTCTTTGTTGG - Intergenic
964675512 3:159275263-159275285 TTATTCTGCTTTGGTTTAATAGG + Intronic
965925824 3:173978488-173978510 TTATCCTTCTTTGTTTTCATAGG - Intronic
966418046 3:179709257-179709279 TTATCCTTCTGTGTATCTCTTGG + Intronic
967702971 3:192616155-192616177 TTATCTTAAGTTGTATTTATTGG + Intronic
968387761 4:157947-157969 TTATATTGCTTTGTATATCTTGG + Intronic
968762583 4:2450334-2450356 TTACCTTGCTTTTTCTTTATTGG - Intronic
969698647 4:8752057-8752079 GTAACCTCCTTTGTATTTCTGGG - Intergenic
970100116 4:12511911-12511933 TTGTGCTCCTTGGTATTTATGGG - Intergenic
971176029 4:24283574-24283596 TTATCATTCTTTCTATTTATTGG - Intergenic
971664459 4:29464049-29464071 CTATCCTACTTGCTATTTATTGG - Intergenic
971836163 4:31765968-31765990 TTATTCTTCTTTGTTTTTACAGG - Intergenic
972484128 4:39526625-39526647 TTATCTTCCTATATATTTATAGG + Intronic
972894428 4:43602076-43602098 TTTACCTGCTTTTTATGTATTGG - Intergenic
974157084 4:58087774-58087796 TTAAGCTGCCTTATATTTATAGG - Intergenic
974696579 4:65383476-65383498 TTTTCTTGCTTTGTTTTTACTGG - Intronic
974843128 4:67321077-67321099 TTGTCCTGCTTAATATTTCTTGG + Intergenic
975490979 4:74988423-74988445 TTATGCTGCTGTGTAAATATGGG + Intronic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
975854593 4:78610401-78610423 TTATCTTGCTTTATATTTAATGG - Exonic
976016758 4:80564402-80564424 TTATCCTTCATTCTGTTTATAGG - Intronic
977072247 4:92406074-92406096 TCTTCCTGTTTTGTATTTGTTGG + Intronic
977402938 4:96557268-96557290 TTATCCTGGTTTGCAATTAAAGG - Intergenic
977405788 4:96597166-96597188 TAATTGTGCTCTGTATTTATAGG + Intergenic
978320826 4:107493616-107493638 TGATCATGTTTTGAATTTATTGG - Intergenic
978627515 4:110704051-110704073 TCATCCTGCTTTATAATTTTTGG + Intergenic
979201612 4:117985644-117985666 ATCTCCTGCTCTGTATTCATGGG - Intergenic
979323577 4:119352676-119352698 TCATCCTGCTATGTAGGTATAGG + Intergenic
980072504 4:128258843-128258865 TTTTCCTGTTTGGTTTTTATTGG - Intergenic
980592372 4:134906935-134906957 TTGTTCTGCGTTGTCTTTATTGG + Intergenic
980820707 4:138012798-138012820 TTAGCTTGCTGTTTATTTATAGG - Intergenic
981529465 4:145737874-145737896 TTATCCTGCTTGGTAATGATAGG + Intronic
981908527 4:149951866-149951888 ATTTCCTGCCTTGTATTTGTTGG + Intergenic
981953481 4:150441239-150441261 TTATCCTGCTTTGTCTTTAGAGG - Intronic
982136828 4:152280192-152280214 TCATCCTACTATGTATTTACTGG + Intergenic
982493032 4:156053459-156053481 TTGTCATGCTTTCTATTTATAGG + Intergenic
982761321 4:159287677-159287699 TTTTCCTTCTTAGGATTTATGGG + Intronic
983241410 4:165237344-165237366 TCATCCTGCTATGTAGGTATAGG + Intronic
983702894 4:170620694-170620716 TTATTCTGATTTGGATTTCTTGG + Intergenic
983745023 4:171187523-171187545 TTATCCTGATTTATCCTTATAGG - Intergenic
983762101 4:171423726-171423748 ATATTCTGCTTTCTATTTATGGG - Intergenic
983836887 4:172398776-172398798 TTATGTTAATTTGTATTTATGGG + Intronic
984231247 4:177102454-177102476 TTATGATCCTTTGTATTTCTGGG - Intergenic
984481874 4:180314624-180314646 TTAGACTTCTTTGTATTCATAGG + Intergenic
986239699 5:5949683-5949705 TTATCCTGCTTAGAGTTCATTGG + Intergenic
986791470 5:11165255-11165277 TTAATCTGCTTTGTATTAAAAGG + Intronic
987525096 5:19037882-19037904 TTAACCTGCTTTATATTTATTGG - Intergenic
987651494 5:20746291-20746313 TTATCCAGCTCTGTGTTTGTTGG - Intergenic
987917562 5:24234532-24234554 TTATGCTGCCCTGTGTTTATTGG - Intergenic
988094711 5:26590866-26590888 TTATTGTGCTTTGTAATTTTTGG + Intergenic
988586404 5:32511310-32511332 ATATCCTTCTGTGTATTTTTTGG - Intergenic
988744067 5:34115172-34115194 TTATCCAGCTCTGTGTTTGTTGG + Intronic
988954321 5:36299063-36299085 TTTGCCTGCTTTGTATTTGCTGG - Intronic
989721761 5:44537288-44537310 TAATCCTGCTTTTTTTTTAGAGG - Intergenic
990444108 5:55877817-55877839 TTATCCTACTTGGTATTCACTGG + Intronic
992552235 5:77869689-77869711 TTATCCTGTTTTGCATTGACTGG - Intergenic
992962372 5:81969090-81969112 TTATACTGCTTTGTAATTTTTGG + Intergenic
993131069 5:83898985-83899007 TTATCCAGCTGTATATTTCTTGG + Intergenic
993275887 5:85858179-85858201 GTTTCCTTCTTTGTATTCATGGG - Intergenic
994066474 5:95548571-95548593 TTATCTTGGTATATATTTATAGG + Exonic
994371585 5:98973455-98973477 TGAACCTGTTTTGTATTTTTTGG + Intergenic
994619530 5:102146583-102146605 TTATCCTGCATTTTATGGATGGG + Intergenic
995114393 5:108462937-108462959 TTAGCATGCTATGTTTTTATAGG + Intergenic
995326588 5:110896312-110896334 TTATCTTGCTTTGGATTTTTTGG + Intergenic
995504693 5:112848047-112848069 TAATGCTGCTTTATATTCATTGG - Intronic
996801035 5:127403215-127403237 TTATCATCCTCTGTATTTAATGG + Intronic
996874217 5:128223599-128223621 CTATAGCGCTTTGTATTTATTGG + Intergenic
996889333 5:128399160-128399182 TTTTCCTACTTTGAATGTATTGG - Intronic
997155666 5:131553994-131554016 TTATCCTCTTTTGGATTTTTTGG - Intronic
999420258 5:151435074-151435096 TTATCCTGCTTGGAATTCACTGG - Intergenic
1001545675 5:172569196-172569218 CTCTCCTGCTAAGTATTTATGGG - Intergenic
1001670812 5:173472242-173472264 TTATGCTGATTTTTGTTTATAGG - Intergenic
1003374339 6:5561648-5561670 TTATCCTGCTTAGTATTTGGAGG + Intronic
1003453544 6:6260256-6260278 TCAGCCTGCTTTGCATTCATAGG - Intronic
1003672709 6:8174346-8174368 TTATCCTGCTTTTTATTCTCCGG - Intergenic
1004014186 6:11717492-11717514 TTATCCTGATTTCTAACTATTGG - Intronic
1004068095 6:12270094-12270116 TTATGATCCTTTGTATTTCTAGG + Intergenic
1005409205 6:25524577-25524599 TTAACATGCTTTGTAATTTTTGG - Intronic
1005420670 6:25645900-25645922 TTATCCTGCTTAAAATTCATGGG - Intergenic
1005576008 6:27189943-27189965 TTTACCTGATTTTTATTTATTGG - Intergenic
1005919776 6:30390669-30390691 TCATCCTAAGTTGTATTTATTGG + Intergenic
1006150885 6:31988640-31988662 TTAACCTGATTTTTATTTATTGG + Intronic
1006157186 6:32021378-32021400 TTAACCTGATTTTTATTTATTGG + Intronic
1007011450 6:38422233-38422255 TTATCCATTTTTGTATATATTGG - Intronic
1007233836 6:40376196-40376218 ATATCCTTTTATGTATTTATTGG - Intergenic
1007262904 6:40576226-40576248 TTATGCTGCTTTGTATTTATTGG - Intronic
1007641577 6:43344612-43344634 TTATCCTGTTTTCTTTTTTTAGG + Intronic
1008011293 6:46470346-46470368 TTATCCAGTTTTATATATATGGG - Intronic
1008741377 6:54613380-54613402 TTATGGTCCTTTGTATTTCTTGG + Intergenic
1009934924 6:70222983-70223005 CTATACTGCTTTTTATTTCTTGG - Intronic
1010739014 6:79477662-79477684 TTATCATGATTATTATTTATTGG - Intergenic
1010803100 6:80200914-80200936 TTTTCCTGTTCTGTATTTAGCGG + Exonic
1010818100 6:80384217-80384239 TTTTCCTGCTTTATATTTGCTGG - Intergenic
1011119801 6:83939448-83939470 TGATCTTGCTTTGTTTTTATGGG + Intronic
1011199826 6:84823482-84823504 TCTGCCTGCTTTGTATTTACTGG - Intergenic
1012136094 6:95558708-95558730 ATATCCTGATTTTTATGTATGGG + Intergenic
1014279626 6:119426963-119426985 GTATCCTGCTTAATATTTCTGGG - Intergenic
1014390849 6:120861670-120861692 TTATGATTCTTTGTATTTAGTGG - Intergenic
1014471281 6:121817770-121817792 TTATCTTCCTTTGTTTTTACTGG + Intergenic
1014526645 6:122509340-122509362 TTAACCTGATTTTTATGTATTGG + Intronic
1014753107 6:125274502-125274524 TTACTCTGCATTGTAATTATAGG + Intronic
1014950266 6:127546101-127546123 TTATCCTGCATTGGATTAAGTGG + Intronic
1015832838 6:137388250-137388272 TTAACATGCTATGTATTTGTAGG - Intergenic
1016474933 6:144416779-144416801 TTATACCATTTTGTATTTATTGG + Intronic
1017387581 6:153903927-153903949 ATTTCCTGCTTTTTATTTTTTGG - Intergenic
1017635332 6:156437452-156437474 TTTTCCTTCTTTTTATTTGTTGG - Intergenic
1017751709 6:157494729-157494751 TTGTCTCCCTTTGTATTTATTGG - Intronic
1018361690 6:163077155-163077177 ATATAGTGCTTTCTATTTATTGG + Intronic
1018499704 6:164393652-164393674 TTTTCCTCCTTTTTATTTTTTGG + Intergenic
1020015984 7:4832178-4832200 TTCTCCCGCTTTGTAATTGTAGG - Exonic
1020214780 7:6181612-6181634 TTATCCTGCTTGGCATTTGGTGG + Intronic
1020932761 7:14419979-14420001 TTATACTGCTGTGCTTTTATTGG + Intronic
1020939957 7:14520062-14520084 TTATCTTATTTTTTATTTATGGG + Intronic
1021416815 7:20395939-20395961 TTATGCTACCTTGAATTTATGGG + Intronic
1021680215 7:23122438-23122460 TTATGCTACTTGGTATTTTTTGG + Intronic
1022168328 7:27795955-27795977 ATATCCTTCTTTGTATATCTAGG + Intronic
1022356233 7:29617296-29617318 TTATCCTGCATTATCTTGATGGG + Intergenic
1022752245 7:33241411-33241433 TTATCCCACTTGGGATTTATTGG + Intronic
1022979034 7:35585968-35585990 TTCTCCTGCAATGTATTTGTTGG - Intergenic
1023238601 7:38117502-38117524 TTATCATGTTTTCTATTTCTTGG - Intergenic
1023718290 7:43066593-43066615 TTATCCATCTTTGCATTTCTGGG - Intergenic
1024119380 7:46221617-46221639 TTATCCTCCTTGGAATTGATAGG - Intergenic
1024391494 7:48818214-48818236 CTATCCTGTTTAGTATTTGTGGG - Intergenic
1024804052 7:53115241-53115263 TTATTCTATTTTGTATATATGGG + Intergenic
1027608960 7:80335432-80335454 TTAACCTGCTATGGATTTCTGGG + Intergenic
1027849958 7:83438380-83438402 TTATTCTGCTTTTTAAGTATGGG - Intronic
1028189399 7:87827505-87827527 CTACCCTGCTTTGTGTTTTTTGG - Intronic
1030244216 7:107363239-107363261 GAATCCTGCTTTGTTTTTATTGG - Intronic
1030388949 7:108901675-108901697 TTATTCTGCTTGGGATTCATTGG + Intergenic
1030541065 7:110831280-110831302 TTTTCCTGCTTTGCTTTTAAGGG + Intronic
1030587965 7:111445158-111445180 TTATCCTTCTCTAGATTTATAGG + Intronic
1030800373 7:113842848-113842870 TTATCCTCTTTTGTTTTGATAGG + Intergenic
1030945003 7:115707525-115707547 TTATCCTGCTTTTCTTTTTTGGG + Intergenic
1031030795 7:116732533-116732555 TTTTGCTGTTTTGTAGTTATTGG + Intronic
1031056888 7:117001686-117001708 TTATCTTTTTTTGTAATTATGGG + Intronic
1031240779 7:119236678-119236700 TTATCCTGGATTGTATTTTGAGG - Intergenic
1031698907 7:124899223-124899245 TAATTCTGCTCTGTATTTACAGG + Intronic
1033313008 7:140276171-140276193 GTTTCCTGCTTTGTAGTTAGAGG - Intergenic
1034682419 7:152939198-152939220 TGATCCTGCCGTTTATTTATGGG + Intergenic
1036531976 8:9599145-9599167 TTATGCTTCTTTTTATTTAGGGG - Intronic
1038470767 8:27816828-27816850 TTATACGGGTTTATATTTATAGG - Intronic
1038750979 8:30295587-30295609 TTATCCTGCTTGGGATTCAACGG + Intergenic
1039166955 8:34692497-34692519 ATATTCTGCTTTGTAATTCTGGG - Intergenic
1039322015 8:36442616-36442638 TTATCCTGCTTGGGATATACTGG + Intergenic
1041651053 8:60303508-60303530 TTTTCCTACTATATATTTATTGG + Intergenic
1041744181 8:61188946-61188968 TTATCCTGCTTAGGATTTCTTGG - Intronic
1042912667 8:73844071-73844093 TTATGCTGCTTAGAATTAATTGG - Intronic
1044254270 8:90041642-90041664 TTAGCTTGCTTTTTCTTTATGGG + Intronic
1044287769 8:90429118-90429140 TTTTCCTGCTTTGTTTTCTTTGG + Intergenic
1044528598 8:93281191-93281213 TTAATCTGCTTAGAATTTATTGG + Intergenic
1044946459 8:97394289-97394311 TCATCTTTCTTTGTACTTATTGG - Intergenic
1045883457 8:107068041-107068063 TTATCTTGATTTGTATTATTTGG - Intergenic
1046071084 8:109254254-109254276 TTACCATACTTTGTATTTCTAGG - Intronic
1046699802 8:117387507-117387529 TTAACCAGCTTTATAATTATGGG + Intergenic
1047089077 8:121553736-121553758 TTATCATTCTTTGTATTGATAGG - Intergenic
1047615983 8:126562906-126562928 TGCTCCTGTTTTGTATTTCTTGG - Intergenic
1048433666 8:134395158-134395180 TAAGCCTTCTTTGTATATATTGG + Intergenic
1050009101 9:1167878-1167900 TTTTCTTGCTTGGGATTTATTGG + Intergenic
1050984370 9:12063452-12063474 TTAGCCTGCTTTTTCTGTATAGG + Intergenic
1051082987 9:13314188-13314210 TTAATCTGTTTTGTATTAATTGG + Intergenic
1051309506 9:15755071-15755093 TTTGCCTTCTTTGTAATTATTGG + Intronic
1051584124 9:18709043-18709065 TTACCCTGCTTTGGATATAAAGG - Intronic
1052257724 9:26478646-26478668 TTATTCTGCTTAGGATTTGTTGG - Intergenic
1052543120 9:29836540-29836562 TAGTTCTGCTTTGTTTTTATCGG + Intergenic
1052686890 9:31768488-31768510 TTATTATGTTTTCTATTTATAGG - Intergenic
1053191124 9:36069775-36069797 TGATCCTGCTGGGTATTTGTAGG - Intronic
1053260910 9:36662981-36663003 TCATCATGCTTTCTATGTATGGG + Intronic
1054710384 9:68505082-68505104 TTATCCTGCTTTGCTTTTGCAGG + Intronic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1055254539 9:74352108-74352130 TTATCATGCCTGGGATTTATAGG + Intergenic
1056757951 9:89394067-89394089 TTTTTCTGCTTCCTATTTATTGG - Intronic
1057093439 9:92282179-92282201 TTATCCTTCTCTCTTTTTATGGG - Intronic
1057927308 9:99164835-99164857 TTATCCTGCTTGGTACTTAGTGG + Intergenic
1058043773 9:100334161-100334183 TTATTCTGCTTGGGATTTAGTGG - Intronic
1058317348 9:103585679-103585701 TTATCATACTTTGTATTTAATGG - Intergenic
1058769761 9:108219111-108219133 TTATCCAGTTTATTATTTATGGG - Intergenic
1058779650 9:108320001-108320023 TTATGCTGCTTCTTATTGATTGG + Intergenic
1058848215 9:108983262-108983284 TACTCCTTCTTTGTTTTTATGGG + Exonic
1060364755 9:122999647-122999669 TTATCCTGCTTGGGATTTGTTGG + Intronic
1061740168 9:132697318-132697340 TTGTCCTGTTTGGTGTTTATAGG - Intergenic
1203381797 Un_KI270435v1:56753-56775 TCCTTCTGCCTTGTATTTATGGG - Intergenic
1187893746 X:23961876-23961898 TTATCCTGCTTGGAATTTCTTGG + Intergenic
1188081579 X:25848658-25848680 TTATCCTGCTTTGGGTTTTCTGG + Intergenic
1188210348 X:27416628-27416650 TCAGCCTGTTTTGTATTTTTAGG - Intergenic
1190386821 X:49889889-49889911 TTATCCTACTTGGTATTTGTTGG - Intergenic
1191901305 X:66043508-66043530 TTATCTTTCTATGTATTTTTAGG - Intergenic
1192718346 X:73666476-73666498 TCTGCCTGCTTTATATTTATTGG + Intronic
1193499296 X:82254361-82254383 TTATCCTGCCTACTATTGATGGG + Intergenic
1194026149 X:88753396-88753418 TCATCCTGGGTTCTATTTATGGG - Exonic
1194196154 X:90895062-90895084 TTATGCTGCTTTTTATATCTAGG + Intergenic
1194806086 X:98329875-98329897 TTACATTACTTTGTATTTATCGG + Intergenic
1194921253 X:99768053-99768075 TTGTCCTGGCTTTTATTTATTGG - Intergenic
1195059992 X:101184857-101184879 TTATCTTGCTTTTCAGTTATGGG - Intergenic
1195378685 X:104251270-104251292 TTTTCCTTCTTTGTATTTTCTGG + Intronic
1195818823 X:108919541-108919563 TTATTTTGCTTTATATTTCTAGG + Intergenic
1196663841 X:118295723-118295745 TTATCTTGCTTTTCAGTTATGGG - Intergenic
1197435997 X:126428988-126429010 TTATCCTAGTTGGAATTTATTGG + Intergenic
1198639852 X:138744591-138744613 TTATCCTGCTTGACATTTTTTGG + Intronic
1199115016 X:143981645-143981667 TTATCATGCTTTCTACTTTTTGG + Intergenic
1199150724 X:144482498-144482520 TCATCCTGTTTTGGATTTGTTGG + Intergenic
1199327245 X:146513580-146513602 CTAACTTGCTTTGTTTTTATAGG + Intergenic
1200541997 Y:4469255-4469277 TTATGCTGCTTTTTATATCTAGG + Intergenic
1201336987 Y:12892183-12892205 TTGTCATGCTTTGTAATTTTTGG - Intergenic
1201569922 Y:15402930-15402952 TTATCTTGCTTTTCAGTTATGGG + Intergenic
1202096397 Y:21252754-21252776 TTATTCTGCATTGCATTTATTGG + Intergenic