ID: 1128407029

View in Genome Browser
Species Human (GRCh38)
Location 15:67352784-67352806
Sequence TTATCCTGCTTTGTATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 412}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128407029 Original CRISPR TTATCCTGCTTTGTATTTAT TGG Intronic