ID: 1128408409

View in Genome Browser
Species Human (GRCh38)
Location 15:67367700-67367722
Sequence CACTGGTGGTACGGGGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128408397_1128408409 12 Left 1128408397 15:67367665-67367687 CCATATGGAGAGTTCTAGACAGT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1128408409 15:67367700-67367722 CACTGGTGGTACGGGGGTAGGGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128408409 Original CRISPR CACTGGTGGTACGGGGGTAG GGG Intronic
900095643 1:939065-939087 CGCTGCTGATACGGGGGGAGCGG - Exonic
901600866 1:10422450-10422472 CACTGCTGGCCAGGGGGTAGTGG - Intergenic
902228787 1:15014166-15014188 CTCTGGGGGTACCTGGGTAGAGG - Intronic
905856241 1:41316667-41316689 CACTGATGGGACAGGGGTTGAGG - Intergenic
909465304 1:75967237-75967259 CAATGAAGGTAAGGGGGTAGGGG - Intergenic
913203982 1:116518644-116518666 CACTGGTGGTCAGGAGGCAGAGG - Intronic
915307782 1:154990521-154990543 CACTGCTGGTAATGGGGAAGAGG + Exonic
916402911 1:164468433-164468455 CATTGGTGGTAGGGGGTTGGTGG - Intergenic
917441690 1:175074150-175074172 CACTGGAGGTTTGGGGGTTGGGG - Intronic
920740961 1:208581091-208581113 CACTGCTGGTAAGAGTGTAGCGG - Intergenic
1062764909 10:54171-54193 CAGTGGGGGAACGGGGTTAGTGG - Intergenic
1065838445 10:29680266-29680288 CACTGGTGGGACGGGGAGAGTGG - Intronic
1072760399 10:98051721-98051743 CACTGGCTGCATGGGGGTAGGGG + Intergenic
1072806629 10:98427544-98427566 TAATGGTGGTCAGGGGGTAGAGG + Intronic
1073083932 10:100876588-100876610 CACGGGTGGGATGGGGGTGGGGG - Intergenic
1074694693 10:116039210-116039232 CATTGGTGGTAAGGAGGTAGTGG + Intergenic
1080489739 11:32750335-32750357 CACTGGTGGTAGTCAGGTAGTGG - Intronic
1080625384 11:34024717-34024739 CACTGCTGGCACTGTGGTAGAGG + Intergenic
1091838499 12:3602688-3602710 CACTGGTGGTGGGGGGATCGGGG - Intergenic
1094092088 12:26661676-26661698 CACTGCTCGTACGGGTGAAGTGG + Intronic
1104170187 12:126273245-126273267 CACTGGCGGGACCTGGGTAGAGG - Intergenic
1104205953 12:126638642-126638664 CACTGGTGCTCGGGGGGTGGGGG - Intergenic
1104707114 12:130955681-130955703 CTCTGGTGGGGCGGGGGCAGAGG - Intronic
1104835369 12:131786713-131786735 CACTGGGGGTGGGGGGGTGGTGG - Intronic
1105202080 13:18189835-18189857 CACTGGTGGTTGGGGGGAATTGG - Intergenic
1109676126 13:65677100-65677122 CACTGGTGGCATGGGAGTAGAGG + Intergenic
1114034773 14:18613064-18613086 GACTAGGGGTACAGGGGTAGTGG + Intergenic
1114123869 14:19701952-19701974 GACTAGGGGTACAGGGGTAGTGG - Intergenic
1117208365 14:53469510-53469532 CACAGGTGGTAACCGGGTAGTGG - Intergenic
1119570800 14:75669909-75669931 GACTGGTGGTATGGGGGCTGGGG - Intronic
1128408409 15:67367700-67367722 CACTGGTGGTACGGGGGTAGGGG + Intronic
1130912489 15:88280695-88280717 CACTGGGGGTATGGGAGTACTGG - Intergenic
1133077700 16:3292409-3292431 CAGTGGTGGTGTGGGGGTTGAGG + Intronic
1136566986 16:31076543-31076565 CACAGGTGGTACAGGGGAAAAGG - Exonic
1136715606 16:32279108-32279130 CCCTGGAGGTAAGGGGGTCGTGG + Intergenic
1136752302 16:32650659-32650681 CCCTGGAGGTAAGGGGGTCGTGG - Intergenic
1136822289 16:33329803-33329825 CCCTGGAGGTAAGGGGGTCGTGG + Intergenic
1136828852 16:33386342-33386364 CCCTGGAGGTAAGGGGGTCGTGG + Intergenic
1136833918 16:33485124-33485146 CCCTGGAGGTAAGGGGGTCGTGG + Intergenic
1137072098 16:35912476-35912498 CAATGGTGGTATAGGGGTGGTGG - Intergenic
1139273257 16:65703268-65703290 CACAGGTGAGAAGGGGGTAGGGG - Intergenic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1203010998 16_KI270728v1_random:239396-239418 CCCTGGAGGTAAGGGGGTCGTGG - Intergenic
1203054448 16_KI270728v1_random:910643-910665 CCCTGGAGGTAAGGGGGTCGTGG - Intergenic
1142920679 17:3182669-3182691 CAGAGGTGGTACAGGGGGAGAGG + Intergenic
1146940430 17:36840333-36840355 CACTGGTGGTACCAAGGAAGGGG - Intergenic
1147053952 17:37819491-37819513 CACTGGTGGTGGTGGGGTTGGGG + Intergenic
1152111923 17:78361232-78361254 CACTGGCGGGGAGGGGGTAGAGG + Intergenic
1152926307 17:83089306-83089328 CACAGGTGGTGACGGGGTAGCGG - Intronic
1152957822 18:54516-54538 CAGTGGGGGAACGGGGTTAGTGG - Intronic
1162968604 19:14167320-14167342 CAGGGGTGGTAGGGGGGTACAGG + Intronic
1163594302 19:18211871-18211893 CACTGGCGGTACAGGGGCAGCGG + Exonic
1165735924 19:38175576-38175598 CACTGGTGGTAGCGGGGGAGGGG - Intronic
1166831452 19:45642040-45642062 CACTGGAGGGATGGGGTTAGGGG + Exonic
1166851609 19:45764095-45764117 CACTGGAGGTGCGGGGGCAGCGG - Exonic
924965610 2:73818-73840 CAGGGGTGGTGGGGGGGTAGAGG - Intergenic
926107351 2:10160639-10160661 CACGGGTGGTCCTGGGGCAGAGG - Intronic
930993224 2:57685449-57685471 CTCAGGTGGTATGGGAGTAGTGG - Intergenic
931202282 2:60109890-60109912 CAGTGGTGGAACAGGGGTGGAGG - Intergenic
931614348 2:64140956-64140978 CACTTGTGGTAGTGGGGGAGGGG - Intronic
938588698 2:132716587-132716609 CACTGGGGGTTCGGTGGTAATGG + Intronic
938849061 2:135241833-135241855 AACTAGTGGTACTGGAGTAGAGG + Intronic
939199665 2:139018276-139018298 CAATGGTGGTATGGGGGCAGGGG + Intergenic
946281139 2:218666245-218666267 CACTGATTAAACGGGGGTAGGGG + Intronic
946725444 2:222657039-222657061 CACTGGGGGTGAGGGGGTGGAGG + Intergenic
947701425 2:232237728-232237750 AAATGGTGGGAGGGGGGTAGAGG + Intronic
1168990864 20:2094986-2095008 CAGAGGTGGCATGGGGGTAGGGG - Intergenic
1172823360 20:37758629-37758651 CACAGGTGGTATCAGGGTAGGGG - Intronic
1175219525 20:57408983-57409005 AGCAGGTGGTGCGGGGGTAGAGG - Exonic
1176715873 21:10348174-10348196 CACTGGTGGTTGGGGGGAATTGG + Intergenic
1178343064 21:31802268-31802290 CACTGTTGGGATGGGGGTTGGGG - Intergenic
1180458893 22:15540112-15540134 GACTAGGGGTACAGGGGTAGTGG + Intergenic
1180602468 22:17031782-17031804 CACTGGTGGTTGGGGGGAATTGG - Intergenic
1183761177 22:39819567-39819589 CACTGGTTGTTAGGGGTTAGTGG + Intronic
1184148393 22:42624599-42624621 CAGAGGTGGAACGGGGGTGGGGG - Intronic
1185083247 22:48721269-48721291 AAATGGTGGCACGGGGGCAGTGG - Intronic
954809829 3:53241055-53241077 GACATGTGGGACGGGGGTAGGGG - Intronic
954873278 3:53784144-53784166 CACTGATGGTGAGGGGGCAGCGG - Intronic
956511579 3:69999495-69999517 CACTTGTGATACGGGAGTACCGG + Intergenic
962514977 3:136141825-136141847 CAGTGGTGGTAGGGAGGAAGAGG + Intronic
969639333 4:8387648-8387670 CACGGGTGGCACGGAGGTGGGGG + Intronic
974292375 4:59948794-59948816 CATTGGTGGTATGCAGGTAGTGG + Intergenic
977053293 4:92157228-92157250 GACTGGTGGTTAGGGGGAAGAGG + Intergenic
977306273 4:95327657-95327679 CACTGGGGCTACAGGGGAAGAGG - Intronic
978940840 4:114434595-114434617 CAATGGTGGCACAAGGGTAGGGG + Intergenic
980620106 4:135290103-135290125 CACTGGTCAGAAGGGGGTAGAGG - Intergenic
981569016 4:146132057-146132079 CACCGGTTGTACTGGGTTAGGGG - Intergenic
985292915 4:188404893-188404915 TCCTGGGGGTACTGGGGTAGGGG - Intergenic
987159962 5:15132166-15132188 CAGTGGTGGTGCGGGGGGGGTGG + Intergenic
992251203 5:74877422-74877444 AACTGGTGGTAGAGGGGTGGGGG - Intergenic
999845054 5:155470164-155470186 CACTGATGGGACGGGGGCACAGG + Intergenic
1002454700 5:179339330-179339352 CGCTGGTGGGCCGGGGGTTGAGG + Intronic
1002580837 5:180208835-180208857 GACTGGAGGCGCGGGGGTAGCGG - Intronic
1004437846 6:15614231-15614253 CATTGGGGGTAGGGGGGTGGTGG + Intronic
1007287728 6:40759855-40759877 GATTGGTGGTACTGGGGTCGTGG - Intergenic
1009303128 6:62052595-62052617 CACTGGTGGGGTGGGGGTGGAGG + Intronic
1010627364 6:78154667-78154689 CAGTGGTGGTAAGGGAGCAGAGG - Intergenic
1014991821 6:128089249-128089271 CACTGTTGGGCCGGGTGTAGTGG - Intronic
1015635447 6:135269916-135269938 CACTGGTGGTAGGGGGATGAAGG + Intergenic
1015872375 6:137790199-137790221 GGATGGTGGTATGGGGGTAGGGG + Intergenic
1016502581 6:144738368-144738390 CTCTGGAGGTTTGGGGGTAGGGG - Intronic
1019921962 7:4168905-4168927 CACTGGTGGTGGGGTGGGAGTGG - Intronic
1020338437 7:7083584-7083606 GTCTGGGGGTAGGGGGGTAGGGG - Intergenic
1022481509 7:30746377-30746399 CACTGGGGGAACCTGGGTAGGGG + Intronic
1023643418 7:42284191-42284213 CTCAGGTGCTACTGGGGTAGGGG + Intergenic
1024439104 7:49395079-49395101 CACTGGTTGTACCGGGATATGGG - Intergenic
1027224145 7:76233545-76233567 CCCTGGTGGAACTGGGGTATAGG + Intronic
1034540674 7:151756083-151756105 CACTGGTGGTCCAGGGGGAGAGG - Intronic
1034971470 7:155422404-155422426 CGCTGCTGGGATGGGGGTAGAGG - Intergenic
1036488376 8:9200479-9200501 CACTGGTGGGCCGGGTGCAGTGG - Intergenic
1036705243 8:11041636-11041658 AACTGCTGGTACGTGGGTAGTGG + Intronic
1043038411 8:75228227-75228249 CATAGGTGGTAAGGGGATAGAGG + Intergenic
1043349810 8:79346431-79346453 CTCTAGTGGTAGTGGGGTAGGGG - Intergenic
1044126719 8:88467722-88467744 GACTGGTGGTAGGGGGCAAGGGG - Intergenic
1045523745 8:102925971-102925993 CAATGGTGGTAGAGGGGTGGAGG + Intronic
1047168555 8:122467029-122467051 CAATGGTGGTCTGGGGGTCGGGG - Intergenic
1047588756 8:126303660-126303682 CACTGGCTGAACAGGGGTAGGGG - Intergenic
1051345709 9:16148999-16149021 TAGTGGTGGTAGGGGGGTTGGGG - Intergenic
1051482079 9:17572072-17572094 CATTGGTAGTAACGGGGTAGGGG + Intergenic
1053263543 9:36693623-36693645 CAATGGTAGTAGGGGGGCAGGGG + Intergenic
1056650999 9:88462313-88462335 CACCACTGGTACAGGGGTAGAGG + Intronic
1058502259 9:105632528-105632550 CACTGTTGGTTCTGGGATAGTGG + Intronic
1059414261 9:114153783-114153805 CATTGGGGGTGCGGGGGTGGCGG + Intergenic
1060795624 9:126510783-126510805 GAATGGTGGTGCGGGGGCAGAGG + Intergenic
1062740334 9:138170088-138170110 CAGTGGGGGAACGGGGTTAGTGG + Intergenic
1186683561 X:11900759-11900781 CACTGGTGGTTGGGTGGTAGTGG + Intergenic
1186917307 X:14237305-14237327 GGCTGGTGGGAAGGGGGTAGTGG + Intergenic
1188986051 X:36769269-36769291 CACTGGTGATACGTGTGTGGAGG - Intergenic
1189422062 X:40864837-40864859 AACTGGTGGTAAGGAGGTATTGG + Intergenic
1194558337 X:95389594-95389616 CACTGCTGCTACGGGAGTGGGGG + Intergenic
1195537551 X:106026184-106026206 TGGTGGTGGTACGGGGGAAGCGG - Intergenic
1199838674 X:151620817-151620839 CACTGGAGGTAAGGAGATAGAGG + Intronic