ID: 1128412110

View in Genome Browser
Species Human (GRCh38)
Location 15:67410126-67410148
Sequence CTGGCTTAAAACACCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128412108_1128412110 5 Left 1128412108 15:67410098-67410120 CCAGTGCACACAGTGATCAGAGC 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1128412110 15:67410126-67410148 CTGGCTTAAAACACCCATCATGG 0: 1
1: 0
2: 0
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128412110 Original CRISPR CTGGCTTAAAACACCCATCA TGG Intronic
903680062 1:25090480-25090502 CTGCCTTAAACCACTCAGCATGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906580383 1:46930775-46930797 CTCCCTTAATACACCCATCGGGG - Intronic
906603340 1:47148113-47148135 CTCCCTTAATACACCCATCGGGG + Intronic
908777851 1:67658821-67658843 CTGCCTGAAAACTCCCTTCAGGG + Intergenic
909491106 1:76227245-76227267 CTGGCTGTAAACAACCAGCATGG + Intronic
912280078 1:108304062-108304084 CTGGCTTGATAGACCCAGCAGGG + Intergenic
912288148 1:108390295-108390317 CTGGCTTGATAGACCCAGCAGGG - Intronic
915228523 1:154428944-154428966 CTGGATTAGAAAACCCTTCAAGG - Intronic
915594179 1:156887123-156887145 CTGGCTGGAAACACCCATAGGGG - Intergenic
917362440 1:174191728-174191750 CTGGCTAATAAAAACCATCAGGG - Intronic
918404926 1:184202390-184202412 CTGCAATAAAACACCCCTCAAGG + Intergenic
919149830 1:193681802-193681824 CTGGCTTAAATCACAAAACATGG + Intergenic
923310547 1:232730514-232730536 CCAGCTTAAAACACCCACAATGG + Intergenic
923339504 1:232995593-232995615 CTGGATTAAAACAAAAATCATGG - Intronic
1065442037 10:25762778-25762800 TTGGTTTAAAAAACCCATAAAGG - Intergenic
1068809703 10:61242007-61242029 CTGGCTTGCCAGACCCATCAAGG - Intergenic
1068983715 10:63087830-63087852 CTGGCCAGAAACACCAATCAAGG - Intergenic
1070733340 10:78846725-78846747 CTGGCATGGAGCACCCATCATGG - Intergenic
1071874573 10:89830587-89830609 CTGGCTTAAAAAGCTTATCAGGG + Intergenic
1074106026 10:110390262-110390284 GTGGCTTAAAACTCACCTCATGG + Intergenic
1079921170 11:26436322-26436344 CTGGCTCAAAAGTCCCAGCAGGG + Intronic
1084952740 11:72675630-72675652 CTGCCTTAAAAGACCCAGCTTGG - Intergenic
1092852714 12:12645641-12645663 CTGTCTTAATACATCCACCAGGG + Intergenic
1093855672 12:24099255-24099277 CCGGCCTAAAACACCCACAAAGG - Intergenic
1094494175 12:30979133-30979155 CTGGCTTGAAACAACCAGCAGGG - Intronic
1094514907 12:31120496-31120518 CTGGCTTAGGACCCCCATCGCGG + Intergenic
1095804178 12:46300539-46300561 CAGACTTAAAACACCTAACAGGG - Intergenic
1096814397 12:54192665-54192687 CTTGCTTAACTCACACATCAAGG - Intergenic
1096921572 12:55092421-55092443 TTGTCTTAAAACATTCATCAAGG + Intergenic
1097971733 12:65640148-65640170 TTGGCTTTAAACACCCATAAGGG - Intergenic
1103869652 12:124082303-124082325 CTGGCTGAAAACAGCCCTTATGG + Intronic
1105952792 13:25245953-25245975 CTGCTGTAAACCACCCATCATGG - Intergenic
1106805553 13:33302946-33302968 CTGGCATTAAAGGCCCATCATGG + Intronic
1107055987 13:36104074-36104096 CTAGCTAGAAACAACCATCATGG + Intronic
1108053206 13:46464629-46464651 CTGGCTTAGGACCCCCATCGCGG + Intergenic
1108881251 13:55120113-55120135 CTGGCTATAATCACCCACCATGG + Intergenic
1109545675 13:63838048-63838070 CTGGCTTAGGACCCCCATCGCGG + Intergenic
1109545910 13:63839036-63839058 CTGGCTTAGGACCCCCATCGCGG + Intergenic
1109546527 13:63841477-63841499 CTGGCTTAGGACACCCATCGTGG + Intergenic
1109546777 13:63842536-63842558 CTGGCTTAGGACCCCCATCGTGG + Intergenic
1110270017 13:73579080-73579102 CTACCTTAAAACTCCCATCTAGG + Intergenic
1110401950 13:75102214-75102236 CTGGCTCAAACCACCACTCAGGG + Intergenic
1110892117 13:80706395-80706417 CTGGCTTAGGACCCCCATCGTGG + Intergenic
1111788038 13:92816044-92816066 GTGGCTTTAAATACCCTTCATGG - Intronic
1113708244 13:112447618-112447640 ATGGCTTAAAGCACACATTATGG - Intergenic
1114902837 14:27086474-27086496 GTTGCTTAATACACCCATTAGGG + Intergenic
1117168361 14:53063979-53064001 CTGCCTTAAAACTCAGATCAGGG - Intronic
1123893533 15:24805056-24805078 GTGGCTTAAGAAACCCATCGAGG - Intergenic
1128412110 15:67410126-67410148 CTGGCTTAAAACACCCATCATGG + Intronic
1129994400 15:79992004-79992026 TTTGCTTAAAACACACAACAGGG - Intergenic
1133301975 16:4787982-4788004 CTGGCTGCAAACACCCATCCTGG - Intronic
1135526397 16:23216488-23216510 TTGGCTTTAAACACCAACCAAGG - Exonic
1137974412 16:53019127-53019149 GTGGCCTAAAAATCCCATCATGG + Intergenic
1138441542 16:57037888-57037910 CCTGCTTTAAACACCCCTCAAGG + Intronic
1140573237 16:76133942-76133964 TTGGCTTAAAAGACCTCTCATGG + Intergenic
1142278042 16:89133240-89133262 CTGTCTTAAACCAGCCATCCAGG - Exonic
1142737208 17:1908537-1908559 CTGGCTTCAAACACCAAACGCGG - Intergenic
1144144736 17:12386548-12386570 CTGGCTTAAATCCCTGATCAAGG + Intergenic
1148797728 17:50205144-50205166 CAGGCTTCAAACACTCAGCATGG - Intergenic
1149030518 17:52077869-52077891 CTGGTTTGAAAAACCCAGCATGG - Intronic
1153786635 18:8541139-8541161 GTTGCTTAAAAAACCCAACAGGG - Intergenic
1156286203 18:35698675-35698697 CTGTTTTAAAACAGCCAACACGG + Intronic
1161529912 19:4782195-4782217 CAGGCTTAAAACAATCATCATGG + Intergenic
1166543473 19:43620651-43620673 CTGGCTTAAAACTCCCCCAAAGG + Intergenic
1167087219 19:47318717-47318739 CTGCAGTAAAGCACCCATCAGGG - Intronic
1167767445 19:51492875-51492897 CTGGCTTCAAACAACAAACATGG - Intronic
1167815236 19:51874928-51874950 GTGGCTTAAAACACCTATGTAGG + Intronic
926001560 2:9337593-9337615 CTGGCTTCTACCAACCATCAAGG - Intronic
927313975 2:21660826-21660848 ATGGCTAAAAACATCCATCCTGG - Intergenic
931426920 2:62179741-62179763 CTAGCTTCTAACACCCACCATGG - Intergenic
935384297 2:102485003-102485025 ATGGCATGAAGCACCCATCAAGG - Intronic
935502616 2:103859478-103859500 CTGGAGTAATACACCCACCAGGG - Intergenic
938789615 2:134665037-134665059 GTGGCTTAAAACACCAATTTAGG - Intronic
941781299 2:169448613-169448635 CTGTCTTAAGACAGCCTTCATGG + Intergenic
944407939 2:199406559-199406581 CTGGCTTATAGTACTCATCATGG + Intronic
946061203 2:216942976-216942998 CTGGCTTAGGCCACCCCTCATGG - Intergenic
947965696 2:234279801-234279823 ATGGCATAAAACACCCATCTTGG + Intergenic
1170119676 20:12898330-12898352 GTGGCTTAAAACAATAATCACGG + Intergenic
1170366335 20:15602153-15602175 CCAGCTTAACACTCCCATCACGG - Intronic
1170589677 20:17762397-17762419 CTGGCTTCACCCTCCCATCACGG + Intergenic
1173957440 20:47045079-47045101 GTGGCTTAAAACAGCAATAATGG + Intronic
1174794778 20:53512921-53512943 ATGTCTTAAAACACTCCTCAAGG + Intergenic
1175490625 20:59378708-59378730 CTGGCTTCAAACCCCCAGCCAGG - Intergenic
1178598119 21:33973146-33973168 CAGGCTTAACTCCCCCATCAAGG + Intergenic
1183060970 22:35336207-35336229 CTGGCAGAAAACATCCAGCAAGG + Intronic
949883860 3:8679659-8679681 CTGGCTTAGGACCCCCATCGCGG + Intronic
952043964 3:29294902-29294924 CTGAGTTAAAAAACCCATCTGGG - Intronic
956943190 3:74188394-74188416 GTGGCTTAAAGCACCCTACATGG - Intergenic
959520385 3:107317519-107317541 CTGGCTTAATAGCCCCAGCAGGG + Intergenic
959584056 3:108009346-108009368 CTGGCTTAAAATAGCCTGCAAGG - Intergenic
970035301 4:11728018-11728040 CTGGCTTCAAACTCCCACCCAGG - Intergenic
976605663 4:86980329-86980351 TTGGCTTAAAAAACCCAGCTGGG + Intronic
977996191 4:103499583-103499605 CTGCTTTTAAACACCTATCATGG + Intergenic
984715425 4:182919955-182919977 CTGGCTTATAGTATCCATCATGG - Intergenic
987011027 5:13765142-13765164 GCAGCTTAAAACAGCCATCATGG + Intronic
987176911 5:15321293-15321315 CCTGCTTAAAATACCCAGCATGG + Intergenic
990409533 5:55527304-55527326 CTGGGTTAAAACAAGCAACAGGG + Intronic
999122500 5:149219929-149219951 CTGGGTGAAAGCACCCAACAGGG - Intronic
1003348669 6:5294989-5295011 GAGGCCTAAAACACCCAACATGG + Intronic
1003712725 6:8611125-8611147 CTGACTTAAAATACTCATTAAGG + Intergenic
1008705347 6:54151722-54151744 GTGGCATAAGATACCCATCATGG - Intronic
1008741429 6:54614200-54614222 CTGACTAAAAACAAACATCATGG + Intergenic
1010016100 6:71106214-71106236 CTGGCTTCACACACCTCTCATGG - Intergenic
1012937587 6:105384225-105384247 CTGGCATGACTCACCCATCAGGG + Intronic
1014668022 6:124263773-124263795 CTGTCTTAAAAGAACCATGAGGG - Intronic
1015917870 6:138236475-138236497 CAGGGTTAAAACACCTTTCAGGG + Intronic
1017559138 6:155607866-155607888 CTGGCTAAAACCACCCCCCAGGG - Intergenic
1023354070 7:39349811-39349833 CTGGCTGAAAACACCAGTCCTGG + Intronic
1026953100 7:74360505-74360527 CTGGAGTAAAGCACCCAGCACGG + Intronic
1028065874 7:86382880-86382902 CTGACTTAAAATATCCATGAAGG + Intergenic
1029042878 7:97596485-97596507 TTGGGTGAAAACTCCCATCATGG - Intergenic
1029887902 7:103892284-103892306 CTGACCAAAAACACCCATGATGG + Intronic
1032356112 7:131212272-131212294 CTGCCTCAAAACAGCCTTCAGGG - Intronic
1032558183 7:132859840-132859862 ATGGCTTTAAACTCCCCTCATGG + Intronic
1034037482 7:147839525-147839547 CTGACCTAAAACAACCTTCATGG - Intronic
1034305071 7:150040739-150040761 CTGGCTTAGGACGCCCATCGGGG - Intergenic
1034305703 7:150043263-150043285 CTGGCTTAGGACGCCCATCGGGG - Intergenic
1034801140 7:154057387-154057409 CTGGCTTAGGACGCCCATCGGGG + Intronic
1034874092 7:154709909-154709931 CTGCTTTGAAGCACCCATCAGGG + Intronic
1037743651 8:21626779-21626801 CTTTCTTAAAACACCCAGAAGGG - Intergenic
1040608871 8:48962809-48962831 CTGGATTCAAACCCCCATGATGG - Intergenic
1043005196 8:74809942-74809964 CTGGCTCAAAACCCACATCACGG - Intronic
1046037676 8:108863933-108863955 CTAGGTTAAAACAACCTTCAAGG - Intergenic
1050357388 9:4795709-4795731 CTTGCTTAAAACATCCCTCATGG + Intronic
1051388144 9:16532861-16532883 CAGGCTGAAATCAGCCATCATGG + Intronic
1055099410 9:72447588-72447610 CTGACTTAAAAAACCCCTAATGG - Intergenic
1055803579 9:80067858-80067880 TTGGGGTAGAACACCCATCAAGG + Intergenic
1056661475 9:88546908-88546930 ATGGACTAAAACATCCATCATGG - Intronic
1057093315 9:92280770-92280792 CTGGATTAACACACACAGCAAGG + Exonic
1059407545 9:114110912-114110934 CTGGCTTAAAGCATCACTCAGGG - Intergenic
1186636902 X:11415915-11415937 GTGGCATAAAAAAACCATCACGG - Intronic
1187669322 X:21653322-21653344 CTGACTTAACACACCCAGAAAGG + Exonic
1187696082 X:21922480-21922502 GTGGCTTAAAATAACAATCAGGG - Intergenic
1190274927 X:48893461-48893483 CGGGCTTTAAATACTCATCAGGG + Exonic
1192905166 X:75543779-75543801 CTGGGTCTAAACACCCAGCAGGG + Intergenic
1195399543 X:104446938-104446960 ATGGGTTAGAACACTCATCAGGG + Intergenic
1198692369 X:139298254-139298276 TTGGCTTAAAACATCCATGAAGG + Intergenic