ID: 1128425755

View in Genome Browser
Species Human (GRCh38)
Location 15:67541400-67541422
Sequence TCTTATGAAGGTGCACGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128425755 Original CRISPR TCTTATGAAGGTGCACGAAT TGG (reversed) Intergenic
910363016 1:86433687-86433709 TCTTAGGAAGGTGCAGGGACTGG - Intronic
918447431 1:184629309-184629331 CCTGATGAAGGTGCAAGAATGGG + Intergenic
918778042 1:188663560-188663582 TCTTATGAAAGTGGGAGAATGGG + Intergenic
1098133367 12:67374831-67374853 TCTTATGCATGTGGAGGAATGGG + Intergenic
1100594943 12:96063558-96063580 TCCTTTAAAGGTGCAAGAATAGG - Intergenic
1103855568 12:123967399-123967421 TCTTATCAATGTGCAAGATTTGG + Intronic
1104266200 12:127235152-127235174 CCTTGTGAAAGTGCACAAATTGG + Intergenic
1104951860 12:132444745-132444767 TCTTTTAAAGGGGCACAAATGGG + Intergenic
1117905677 14:60583514-60583536 TCTTATGAAGGGGGACAGATGGG - Intergenic
1124260304 15:28183547-28183569 TCTTTTCAAGTTGCAAGAATTGG - Intronic
1127170753 15:56299034-56299056 TCTTATGAAGGTGCTTTATTGGG - Intronic
1128425755 15:67541400-67541422 TCTTATGAAGGTGCACGAATTGG - Intergenic
1130802970 15:87285717-87285739 TCTAAAGAAGGTACACAAATAGG + Intergenic
1135756578 16:25103820-25103842 GCTTATGAAGGTGCAGGGCTAGG - Intergenic
1140294083 16:73690986-73691008 TCTTATGCAGGTGGAAAAATTGG - Intergenic
1141460058 16:84173018-84173040 TCCTTTGATGGGGCACGAATAGG + Intronic
1144294876 17:13864599-13864621 TCTTATGAAAATGAAGGAATAGG + Intergenic
1148331190 17:46814869-46814891 TCTTAGGCAGGTGCTCGAGTGGG + Intronic
1153681630 18:7506415-7506437 TCTTATGATGGAGCACAATTAGG + Intergenic
1159291700 18:66431686-66431708 TCTTATGAAAGTCTAAGAATAGG + Intergenic
1163208340 19:15820959-15820981 TCTTATGTAGCTGCAGGGATTGG + Intergenic
925547111 2:5028729-5028751 TTTTATGAAAGTGCACAAGTAGG + Intergenic
927795523 2:26045002-26045024 TTTTTTGGAGGGGCACGAATAGG + Intronic
928214523 2:29350265-29350287 TCTTGTGAATGTGAAGGAATTGG + Intronic
929580574 2:43079535-43079557 TCACATGAAGGTGCATGGATGGG + Intergenic
930457040 2:51618257-51618279 TCAAATGAAGGTGCATGATTAGG - Intergenic
931111880 2:59119838-59119860 TCTTATGAATGTGCAGAAAAAGG + Intergenic
932696504 2:73961263-73961285 TCATATGAAATTGCAGGAATAGG - Intergenic
933413311 2:81951643-81951665 TCAAACGAAGGTGGACGAATAGG - Intergenic
939088018 2:137744889-137744911 TCTTATGAAGGTGTTGGAGTAGG - Intergenic
944219333 2:197286710-197286732 GCTTATGAAACTGTACGAATTGG + Intronic
1170188360 20:13618011-13618033 TCTTGTGCAGCTGCAGGAATAGG - Intronic
1182758374 22:32699612-32699634 TCTTTTGAAGGTAAACAAATTGG - Intronic
955587154 3:60492433-60492455 ACTTCTTAAGGTGCAAGAATTGG + Intronic
961771127 3:129250695-129250717 TCTTCTCAAGGTGCTGGAATGGG - Exonic
962860166 3:139392158-139392180 TCTTATGAAGAGGTAGGAATAGG - Intergenic
963968640 3:151403303-151403325 TGAGATGAAGGTGCACGAACTGG - Intronic
982453617 4:155581267-155581289 TCTTATGAATGAGCAAGAAAAGG + Intergenic
985606497 5:860983-861005 GCGTATGAAGGTGCATGTATGGG - Intronic
987483113 5:18484586-18484608 TCTTCTCAAGGGGCACAAATGGG + Intergenic
989535345 5:42557259-42557281 TCATATGAAGGTCCAGGAAAGGG - Intronic
989644094 5:43610486-43610508 TCTTATTAAGGTGAAGGAACAGG + Intronic
1000484417 5:161822657-161822679 ACTTGTGAAGGTACAGGAATAGG + Intergenic
1010484831 6:76397734-76397756 TCTTTTGAAGGTGAAAAAATAGG - Intergenic
1010962724 6:82164799-82164821 TCATATGAAGGTGAAGGGATTGG + Intergenic
1014694805 6:124606821-124606843 TCTTTGGAAGGAGCAAGAATGGG - Intronic
1015737466 6:136416245-136416267 TTTTATTAAGATGCACCAATGGG + Intronic
1018426682 6:163689223-163689245 TCTTATGAATGTGCTTGAATGGG + Intergenic
1028928234 7:96383688-96383710 TCTTATGAAAGTGAATAAATTGG - Intergenic
1030244564 7:107368215-107368237 TCTTATGAAGAAGCATTAATTGG + Intronic
1038152550 8:24955828-24955850 TCTGAAGAAAGTGCACGAAGAGG - Exonic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1040019475 8:42727576-42727598 TTTTATAAAGGTGCAGGAATGGG - Intronic
1047964919 8:130039362-130039384 CCTTATGAAGGGGAACGAAAGGG + Intergenic
1051474743 9:17493538-17493560 GCTTTTCAAGGTGCAAGAATAGG - Intronic
1195045657 X:101052156-101052178 TCTTATGTAGATCCACCAATGGG - Intergenic
1196814350 X:119653236-119653258 TCTAGTGAAGGTGCACAGATGGG - Intronic