ID: 1128427260

View in Genome Browser
Species Human (GRCh38)
Location 15:67554622-67554644
Sequence CTCTGCACCTTTACTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128427257_1128427260 6 Left 1128427257 15:67554593-67554615 CCTCCGGTGATTCCAGATGGCAT 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1128427260 15:67554622-67554644 CTCTGCACCTTTACTAGAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1128427258_1128427260 3 Left 1128427258 15:67554596-67554618 CCGGTGATTCCAGATGGCATTAA 0: 1
1: 0
2: 2
3: 10
4: 125
Right 1128427260 15:67554622-67554644 CTCTGCACCTTTACTAGAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1128427259_1128427260 -6 Left 1128427259 15:67554605-67554627 CCAGATGGCATTAATCTCTCTGC 0: 1
1: 0
2: 1
3: 12
4: 109
Right 1128427260 15:67554622-67554644 CTCTGCACCTTTACTAGAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128427260 Original CRISPR CTCTGCACCTTTACTAGAGC AGG Intronic
908043496 1:60142493-60142515 CTCTGCTCCTTCACTAGCCCTGG + Intergenic
910066388 1:83157084-83157106 CTCTGCCCTTTTACTAGATCTGG + Intergenic
914227714 1:145735295-145735317 CACTGCACCTGGACTAGATCTGG - Intronic
1062888214 10:1035694-1035716 CTCTGCTCATTTACTGGAACTGG + Intergenic
1063172761 10:3524233-3524255 CTTTGCATTTTTACTAGAGATGG - Intergenic
1064392907 10:14956882-14956904 TTTTGCATCTTTAGTAGAGCTGG - Intergenic
1069646890 10:70006563-70006585 CTCTGCACCAATGCTAGTGCAGG - Intergenic
1070664010 10:78331063-78331085 CTCTGCACCTTTGCTGCTGCTGG - Intergenic
1070942234 10:80357578-80357600 CTCTGCACCTTTGCTCTTGCTGG + Intronic
1071114725 10:82204638-82204660 CTCTCCACCATTACTAGCCCTGG + Intronic
1073290116 10:102409274-102409296 CTCTGCGGCTTGGCTAGAGCGGG + Intronic
1075160780 10:120022935-120022957 CTAAGCACCATTAGTAGAGCTGG - Intergenic
1077112442 11:867820-867842 CTCTGCCCCTTTAAGTGAGCTGG + Intergenic
1081956670 11:47098403-47098425 CTCTTCATCTTGTCTAGAGCAGG + Intronic
1086120776 11:83302725-83302747 CTCTGCACCTCTCCTTGATCAGG - Intergenic
1091133346 11:133165374-133165396 CTCTGCACCTTGGCTGCAGCAGG + Intronic
1091641433 12:2240445-2240467 ATCTGCACCTTTACTGAGGCAGG + Intronic
1093022950 12:14219817-14219839 CTCTACTCCTTTACTAGGGAGGG + Intergenic
1101062983 12:100990640-100990662 GTCTGCATCTTTACTACACCAGG - Intronic
1103337735 12:120202324-120202346 CTCTGCTGCTTTTCCAGAGCAGG + Intergenic
1104736564 12:131139039-131139061 CTCTGCACCTTTCCTCCCGCAGG + Intronic
1105415780 13:20210389-20210411 CTCTGCTTCTCTACTAGGGCAGG - Intergenic
1105641456 13:22269204-22269226 CTCTGCATGTTTAATAGGGCGGG + Intergenic
1107032884 13:35871210-35871232 CTCTGCTGCTTTACCTGAGCTGG + Exonic
1107704526 13:43087333-43087355 CACTACACTTTTACTAGAGCAGG - Intronic
1110321091 13:74160812-74160834 CACTTCAACTTAACTAGAGCAGG - Intergenic
1115432017 14:33330070-33330092 TTCTGCATTTTTAGTAGAGCTGG - Intronic
1115993643 14:39174123-39174145 CTCTTCACCTGGCCTAGAGCTGG - Intergenic
1118155278 14:63234270-63234292 ATCTGCGCCTTTATTACAGCAGG + Intronic
1118722721 14:68605835-68605857 CTCTGCACCCTTTCTTTAGCTGG + Intronic
1119777494 14:77258031-77258053 CTCAGCACCTTTGCCACAGCCGG + Exonic
1120710001 14:87783169-87783191 CTCTGCATCTCTAATAAAGCTGG - Intergenic
1121423993 14:93835133-93835155 CTCTGCAGCTTTGCTGGAGGTGG + Intergenic
1122275385 14:100588140-100588162 CGCTGCACCTTTACCAGGGTAGG - Intergenic
1125534506 15:40435717-40435739 CTCTGCACCTTTGCTGAAACTGG + Intronic
1128427260 15:67554622-67554644 CTCTGCACCTTTACTAGAGCAGG + Intronic
1128733125 15:70034262-70034284 CTCTGCACCATTCCCAGAGCAGG - Intergenic
1135260980 16:20980542-20980564 TTCTGCACTTTTAGTAGAGATGG + Intronic
1135963671 16:27018503-27018525 CTCAGCAACGTTACTAGTGCAGG + Intergenic
1136649098 16:31650783-31650805 CTCTGCACTTCTAGTAGAGATGG - Intergenic
1137873108 16:51969883-51969905 CTATGCATCTTTCCTAGAGAGGG - Intergenic
1138129543 16:54467993-54468015 CTGTTCACCTCTACAAGAGCTGG - Intergenic
1140596712 16:76424581-76424603 TTCTGCATTTTTACTAGAGATGG - Intronic
1145246540 17:21273334-21273356 GTCAGCACGTTTCCTAGAGCAGG - Intergenic
1145750079 17:27349311-27349333 CTCCGCACCTTTGGTAGGGCAGG - Intergenic
1148671005 17:49410051-49410073 CTCTGTACTTTTTGTAGAGCTGG + Intronic
1151841562 17:76621850-76621872 CTCTGAACCTTTACTGGTTCAGG + Intergenic
1153791646 18:8584640-8584662 CTCTCCAACTTTACTAGCGCAGG - Intergenic
1155436799 18:25821095-25821117 ATCTGCACCTTTCCTCAAGCGGG - Intergenic
1156344696 18:36246510-36246532 CCCGCCACCTTCACTAGAGCAGG - Intronic
1157247558 18:46067786-46067808 CTCTGAACCTTTACTGGTTCAGG + Intronic
1158291533 18:55950386-55950408 TTCTCCTCCTTTACTTGAGCCGG - Intergenic
1164586161 19:29477454-29477476 CCCTGGACCCTTACTGGAGCAGG + Intergenic
1164642319 19:29835147-29835169 CTGTGCACCTTAACTAGATGTGG + Intergenic
1165033693 19:33017607-33017629 CTCAGCACTTTTACTGGAGGTGG + Intronic
1166208757 19:41291692-41291714 CACTGCACCTGTCCTAAAGCAGG - Intronic
936116321 2:109705925-109705947 ACCTGCACCTTTACCAGAGATGG + Intergenic
938206714 2:129430438-129430460 ATCTGCACCATGACTAGAGGAGG - Intergenic
939115956 2:138060696-138060718 CTCTCTACCTTTACTAGGCCAGG + Intergenic
940699672 2:157024830-157024852 TTCTGCAAATTTACTAGAGAAGG + Intergenic
941111820 2:161424557-161424579 CTCTTCACCTTTAGGAGACCTGG + Exonic
946554484 2:220840329-220840351 CTCAGCACATTTTCTAGACCTGG + Intergenic
946797594 2:223372322-223372344 CTCTGGTCCTTTTCTTGAGCTGG + Intergenic
1172894314 20:38288834-38288856 CTCTACACCTTTACTGAAGATGG + Intronic
1172978513 20:38924060-38924082 TTCTGCATCTTTAGTAGAGATGG - Intergenic
1177737721 21:25113717-25113739 CTTTGCAGTTTTACTATAGCAGG + Intergenic
1182159752 22:28109728-28109750 CTCTCCACCTTTTCTAGTGGTGG - Intronic
1183905439 22:41036806-41036828 TTCTGCATTTTTACTAGAGATGG + Intergenic
952656272 3:35789732-35789754 CTCTGCACCTTTACTAGGATGGG + Intronic
953928378 3:46993854-46993876 CTCTGCACCTTTTTTACTGCAGG + Intronic
960232634 3:115245964-115245986 CTCTGCACCTTTTGCAGAGTGGG - Intergenic
960814916 3:121662562-121662584 CTTTGCACTTTTAGTAGAGATGG - Intergenic
963333445 3:143943398-143943420 CTCTGCATTTTTAGTAGAGACGG - Intergenic
963623875 3:147646572-147646594 CTTTGAACCTGTACTAGAACTGG + Intergenic
964065250 3:152570247-152570269 CTCTGCAGCTTTATTTGGGCAGG - Intergenic
964168257 3:153735453-153735475 CTCTGAACCTTTACTGGTTCAGG + Intergenic
965118898 3:164524478-164524500 GGCTGCACATTTACTGGAGCTGG - Intergenic
966161128 3:176969572-176969594 CTCTGGGCCTTTATTAGAACTGG + Intergenic
973217791 4:47690346-47690368 CTCTGCACCTGTACAAAAGGTGG + Intronic
978366525 4:107988945-107988967 CTCTGAACCTTTACTGGCTCAGG + Intergenic
981536322 4:145803706-145803728 CTCTAGAACTTTAATAGAGCTGG + Intronic
986597908 5:9442440-9442462 CTATGCACCTTTTCCACAGCTGG + Intronic
986823054 5:11489929-11489951 ATCTGAGCCATTACTAGAGCAGG - Intronic
988022241 5:25635911-25635933 CTCGGCACCATTTCTTGAGCAGG + Intergenic
989131823 5:38114506-38114528 TTCTGCACCTTTAGTAGAGACGG + Intergenic
995916528 5:117252763-117252785 CTCTGAATCTTTACTAGTTCAGG - Intergenic
997108529 5:131048361-131048383 CTCTGTACTTTTAGTAGAGATGG - Intergenic
997642626 5:135459269-135459291 TTCTGCTCCTTTGCTCGAGCAGG - Intergenic
999481859 5:151956059-151956081 CTGGGCAGCATTACTAGAGCAGG + Intergenic
999835309 5:155364081-155364103 GTCTGCTTCTTTACTAGCGCAGG - Intergenic
999838750 5:155401862-155401884 TTTTGCACCTTTAGTAGAGACGG + Intergenic
1002203298 5:177544282-177544304 CTCTGCTCCCTTACCAGATCAGG + Intronic
1004086351 6:12453279-12453301 AGCTGCCCCTTGACTAGAGCAGG + Intergenic
1007165299 6:39824778-39824800 CTCTGGACCTTGCCTGGAGCTGG - Intronic
1008169153 6:48180922-48180944 CTCTGCAGCTTTCCTGGAGAGGG + Intergenic
1010653796 6:78487677-78487699 CTCTGCCCCTTCACTGGAGCTGG + Intergenic
1010699781 6:79029698-79029720 TTCTGTATCTTTACTAGAGATGG + Intronic
1013121006 6:107140470-107140492 CTCTGCACAGTTACTATAACAGG + Intergenic
1018933349 6:168256849-168256871 CTCTGCACCATTAGTGGCGCTGG - Intergenic
1022756895 7:33303120-33303142 TTCTGCACCTTTACTGGATTTGG + Intronic
1025281803 7:57631408-57631430 CTATGCTCCATTACTGGAGCAGG + Intergenic
1025302926 7:57834109-57834131 CTATGCTCCATTACTGGAGCAGG - Intergenic
1027277723 7:76577675-76577697 CTCTGCCCTTTTACTAGATCTGG - Intergenic
1027907457 7:84204047-84204069 CTCTTCAGATTTACTATAGCCGG + Intronic
1028179237 7:87698270-87698292 CTTTGCACTTTTAGTAGAGAGGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1035208839 7:157312746-157312768 CTCTGCATTTTTAGTAGAGATGG - Intergenic
1035759924 8:2061688-2061710 CTCTGCAGATTCACTAGAGTTGG + Intronic
1039898012 8:41729967-41729989 CTCTGCTCCTTAAGTAGTGCAGG - Intronic
1042459514 8:69047165-69047187 TTCTGCTCCTTTGCTAGAGATGG - Intergenic
1043045398 8:75316453-75316475 CTTTGCATTTTTAGTAGAGCTGG + Intergenic
1047807976 8:128379118-128379140 CCCTCCTCCTTTACTAGAGAGGG - Intergenic
1049088245 8:140494336-140494358 CTCTGCACCCTAACTGCAGCTGG + Intergenic
1052440241 9:28487190-28487212 CTCTGTACCTTTCCAATAGCAGG + Intronic
1053588610 9:39487021-39487043 CTTTGCATCTTTACTAGAGACGG + Intergenic
1054577694 9:66878273-66878295 CTTTGCATCTTTACTAGAGACGG - Intronic
1054954745 9:70896279-70896301 CTGTGCTCCCTTTCTAGAGCAGG + Intronic
1056106833 9:83355358-83355380 CTGTGCATCTTTACTAGACTGGG + Intronic
1058410452 9:104725313-104725335 CTCTGCCCCTTCACCAGAACAGG + Intergenic
1187693400 X:21894413-21894435 TTCTGTATTTTTACTAGAGCTGG + Intergenic
1194375589 X:93128925-93128947 CTCTGCATCTTGAGTAGATCTGG - Intergenic
1194405118 X:93487434-93487456 CTCTGCACCTTATTCAGAGCTGG - Intergenic
1200019988 X:153195219-153195241 CTCTGCTCCTCTAATAGATCAGG + Intergenic
1200884254 Y:8252844-8252866 CTCTGCAACTTTGCAAGAGCTGG - Intergenic
1202232590 Y:22671483-22671505 CCCTGCAACTTTGCAAGAGCTGG + Intergenic
1202243001 Y:22789607-22789629 TTCTGCACCCTTACTAGGGAGGG + Intergenic
1202310566 Y:23524675-23524697 CCCTGCAACTTTGCAAGAGCTGG - Intergenic
1202395988 Y:24423357-24423379 TTCTGCACCCTTACTAGGGAGGG + Intergenic
1202474797 Y:25246735-25246757 TTCTGCACCCTTACTAGGGAGGG - Intergenic
1202560236 Y:26145919-26145941 CCCTGCAACTTTGCAAGAGCTGG + Intergenic