ID: 1128431517

View in Genome Browser
Species Human (GRCh38)
Location 15:67599638-67599660
Sequence TTGCATGGGCAGAAAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128431517_1128431526 20 Left 1128431517 15:67599638-67599660 CCATCCATTTTCTGCCCATGCAA 0: 1
1: 0
2: 0
3: 23
4: 324
Right 1128431526 15:67599681-67599703 ATTGATTTTTTTTTTTTTCAGGG 0: 1
1: 23
2: 138
3: 1471
4: 14698
1128431517_1128431527 30 Left 1128431517 15:67599638-67599660 CCATCCATTTTCTGCCCATGCAA 0: 1
1: 0
2: 0
3: 23
4: 324
Right 1128431527 15:67599691-67599713 TTTTTTTTCAGGGCTTGCAGTGG 0: 1
1: 0
2: 1
3: 33
4: 334
1128431517_1128431522 -5 Left 1128431517 15:67599638-67599660 CCATCCATTTTCTGCCCATGCAA 0: 1
1: 0
2: 0
3: 23
4: 324
Right 1128431522 15:67599656-67599678 TGCAAGGCAGTGCAATTCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 143
1128431517_1128431525 19 Left 1128431517 15:67599638-67599660 CCATCCATTTTCTGCCCATGCAA 0: 1
1: 0
2: 0
3: 23
4: 324
Right 1128431525 15:67599680-67599702 AATTGATTTTTTTTTTTTTCAGG 0: 1
1: 11
2: 177
3: 1841
4: 10823

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128431517 Original CRISPR TTGCATGGGCAGAAAATGGA TGG (reversed) Intronic
902710549 1:18236600-18236622 TGGCATTGTCAGAGAATGGATGG + Intronic
902721193 1:18305297-18305319 ATGCATGGATAGATAATGGATGG + Intronic
902741838 1:18444252-18444274 TTGAATGGGAAGGAACTGGAAGG - Intergenic
903558996 1:24214029-24214051 TTGTAAGGACAGAAGATGGAGGG - Intergenic
906219274 1:44065916-44065938 ATGAATGGGCAATAAATGGATGG + Intergenic
908637727 1:66186928-66186950 CTGAATGGGCACAAACTGGAAGG - Intronic
909799814 1:79792446-79792468 TTGCATGTGCAGATTCTGGAGGG - Intergenic
910382769 1:86646366-86646388 TAGCATTGGCAGAAACTGGGCGG - Intergenic
911304903 1:96221850-96221872 TTCCATTGCCAGAAAATGTAAGG - Intergenic
913001813 1:114588140-114588162 ATGTATGGGAAGAAAATGAAGGG - Intronic
915799160 1:158770285-158770307 TTGCTTAGGCAGAGTATGGAGGG - Intergenic
916247286 1:162701327-162701349 TGGCATTTGCAGTAAATGGAAGG + Intronic
916973830 1:170052889-170052911 TTGAATGGGCAAAAGCTGGAAGG + Intronic
918309139 1:183273167-183273189 TTTTATGGACAGAAAAAGGAAGG - Intronic
919559714 1:199101554-199101576 TTTCATGGGCAAAAAATGAAAGG + Intergenic
920388117 1:205582100-205582122 GGGCATGGGCTGAAAAGGGAAGG - Intronic
921184935 1:212662075-212662097 CTGAATGGGCAAAAACTGGAAGG + Intergenic
921948939 1:220908958-220908980 TTGCAGAGGAGGAAAATGGAAGG + Intergenic
922155259 1:223036083-223036105 TTACATGGGGAGAAAATAGAAGG + Intergenic
922959530 1:229634691-229634713 TTGCATTGGTAGAAGATGGATGG + Intronic
923262284 1:232278871-232278893 GTGCCTAGGCAGCAAATGGAAGG + Intergenic
923518684 1:234719565-234719587 TTGCAGGGGCAGAAGCTGAAAGG - Intergenic
924903525 1:248427748-248427770 TTGCATGATCAAAAAATGGTGGG - Intergenic
924924342 1:248664229-248664251 TTGCATGATCAAAAAATGGTAGG + Intergenic
1063246090 10:4220281-4220303 ATGCTGGGGCAGAAAAAGGAAGG - Intergenic
1064686587 10:17868009-17868031 TTGCATAAGGAGAAAATGAATGG - Intronic
1065548299 10:26844534-26844556 CTGCGTGGGCAGAACAGGGAAGG - Intronic
1065858897 10:29854013-29854035 TTGCATGGTCCTCAAATGGAAGG + Intergenic
1067046219 10:42986558-42986580 TAGCCTGGTCAGGAAATGGAAGG - Intergenic
1067340735 10:45401196-45401218 TTCCAAGGGAAGAAAGTGGAAGG + Intronic
1067969896 10:50958024-50958046 TTGGATGGGCAGAGGATGGCGGG + Intergenic
1071238631 10:83678937-83678959 TGACATGGACAGAGAATGGAAGG + Intergenic
1072082324 10:92044601-92044623 TTTAGTGGGCAGAAAAGGGATGG + Intergenic
1072387833 10:94950236-94950258 TTGAATGGGCAGAAGCTGGAAGG + Intronic
1073743697 10:106441088-106441110 TTGCATGGGTAGTATATGGCTGG + Intergenic
1074229980 10:111524020-111524042 TTTTTTGGGGAGAAAATGGAAGG + Intergenic
1074988263 10:118677275-118677297 TTGAAAGTGAAGAAAATGGAAGG - Exonic
1076262617 10:129079704-129079726 TTGTACGGCCAGAAAATGAAGGG + Intergenic
1076422576 10:130341613-130341635 TTTCTTGGGCATACAATGGAAGG + Intergenic
1078267121 11:9763737-9763759 CTGGATGGACAGCAAATGGAGGG + Intergenic
1080861796 11:36156394-36156416 GTGCCTTGGCAGAACATGGATGG + Intronic
1081064351 11:38521646-38521668 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1083023269 11:59528683-59528705 CAGTATGGGCAGAACATGGAGGG + Intergenic
1084005970 11:66323769-66323791 ATGCTTGGGCAGAAGATGGATGG + Intergenic
1085756164 11:79202992-79203014 TTACACAGGAAGAAAATGGAGGG + Intronic
1087609764 11:100420386-100420408 ATGCCTGGCCAGAAACTGGAAGG - Intergenic
1088819600 11:113446128-113446150 ATGCATGGGAAGTACATGGAGGG + Intronic
1089781990 11:120879756-120879778 TCGCATGTGCAAAAACTGGAGGG - Intronic
1090581933 11:128170186-128170208 TTTACTAGGCAGAAAATGGAGGG + Intergenic
1091032852 11:132206698-132206720 TTGCATGGGCACAGATGGGAAGG - Intronic
1091156976 11:133383126-133383148 TTGGATAGGCAGGAAAGGGAGGG - Intronic
1091900095 12:4137515-4137537 TTCAATGAGGAGAAAATGGAAGG + Intergenic
1091997403 12:5004584-5004606 ATTTATGGACAGAAAATGGAAGG + Intergenic
1092164857 12:6336524-6336546 TTGCATGGGGAGGGGATGGATGG - Intronic
1093165502 12:15801187-15801209 AGGCAGGGGCAGAATATGGAAGG - Intronic
1093644609 12:21570656-21570678 TGGCATGTGCAGAAAATAGCAGG + Intronic
1095396031 12:41763383-41763405 ATGCATGGGCACACAAAGGAAGG + Intergenic
1096263714 12:50108051-50108073 CTGAATGGGCAGAAACTGCAGGG + Exonic
1096920391 12:55078918-55078940 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1099525856 12:83718922-83718944 TTACATGTGCAGAATATGCAGGG - Intergenic
1099543827 12:83950861-83950883 TTTTATGGGCACAAAATGGGGGG - Intergenic
1099737448 12:86588043-86588065 CTGAATGGGCACAAACTGGAAGG - Intronic
1099744605 12:86686430-86686452 GTGAATGGGCAAAAACTGGAAGG - Intronic
1099870579 12:88344158-88344180 TAGCAGGGGAATAAAATGGATGG - Intergenic
1101622847 12:106406778-106406800 TTAAATGGGAAGAAAATTGAGGG - Intronic
1103453970 12:121050252-121050274 ATAAATGGGCAGAAAATTGAAGG + Intergenic
1105439046 13:20400756-20400778 TTGCTAGGGCATAAATTGGAAGG - Intergenic
1107419037 13:40229028-40229050 TTCCAAGGCCACAAAATGGAGGG + Intergenic
1108565428 13:51692288-51692310 CTGAATGGGCAAAAACTGGAAGG - Intronic
1108572460 13:51764991-51765013 TTGCAAGAGCAGGAAGTGGAGGG - Exonic
1109004951 13:56861966-56861988 TTGAATGGGAAGAAAAAGTATGG + Intergenic
1109257581 13:60101865-60101887 CTGCATTGGAAGAAAATGGAAGG - Intronic
1110220852 13:73071344-73071366 TTGAATGGGCACAATATTGATGG + Intronic
1111476385 13:88753948-88753970 TTGCATGAGCAGAAAGTAAAAGG - Intergenic
1111584402 13:90265635-90265657 TTGGATGGGCAGAAAGTGTGGGG - Intergenic
1115195009 14:30788147-30788169 ATGGATGGGGAGAAAAGGGAAGG + Intergenic
1116026681 14:39523651-39523673 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1116226059 14:42153770-42153792 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1117104404 14:52383270-52383292 TAGCAAGGGAACAAAATGGATGG + Intergenic
1117202821 14:53410001-53410023 TTACAGGGGCAGAGAATGGAGGG + Intergenic
1117453037 14:55870472-55870494 TGGCATGGGGAAAAAATGGTGGG - Intergenic
1117640186 14:57790041-57790063 CTGAATGGGCAAAAACTGGAAGG + Intronic
1118016113 14:61662932-61662954 TTGCATGGACAGAAAAATGAGGG - Intergenic
1118620808 14:67612368-67612390 ATGCATGTTCAGAAAATGGTGGG + Intergenic
1120899500 14:89563618-89563640 TTAGATGGGCAGAAAGGGGAGGG + Intronic
1121545232 14:94758373-94758395 TTGGCTGGGCAGATACTGGAAGG - Intergenic
1124220885 15:27848574-27848596 CTGCATGGGAAGACAATGCATGG + Intronic
1124685340 15:31777510-31777532 CAGGATGGACAGAAAATGGAGGG + Intronic
1125602504 15:40923357-40923379 TTGTAGGGTCAGAGAATGGAGGG - Intergenic
1126692908 15:51301585-51301607 TTGGATGGCCAGAAAAAGTAGGG - Intronic
1127001425 15:54512336-54512358 TTCCATGAGCAGAAGAAGGAAGG + Intronic
1127931555 15:63600502-63600524 GTGCAGGGGCAGAAAGAGGAGGG + Intronic
1128431517 15:67599638-67599660 TTGCATGGGCAGAAAATGGATGG - Intronic
1128505461 15:68267959-68267981 TTGCATTGGCAGAAGGTGAAAGG + Intergenic
1129924145 15:79347428-79347450 CTTAATGGGCAGAAGATGGAAGG + Intronic
1130300706 15:82678180-82678202 TTGGAGAGGCAGAAAATGGGTGG + Intronic
1132390003 15:101431647-101431669 TTGCAGGTGCAGAAAAAGCAAGG - Intronic
1133642183 16:7727635-7727657 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1135177330 16:20242237-20242259 ATGAATGAGCTGAAAATGGAAGG - Intergenic
1135805292 16:25537091-25537113 TTGAATGGGCAGCCAATAGAGGG + Intergenic
1136385203 16:29920956-29920978 TTGTAGGGGCAGGAACTGGAAGG + Intronic
1137371814 16:47913895-47913917 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1137377098 16:47961561-47961583 AGTCATGAGCAGAAAATGGAGGG + Intergenic
1138279026 16:55758829-55758851 TTGCATGGGAAAATATTGGAAGG - Intergenic
1138723939 16:59115635-59115657 TTGCATGGGTAGCTAATGGTAGG - Intergenic
1138992058 16:62402585-62402607 TTGCATGGGCTAAACATGAAAGG - Intergenic
1139121189 16:64019537-64019559 TTACATGGGCAGAAAACAGTGGG - Intergenic
1139229542 16:65270325-65270347 CTGTATGGGTGGAAAATGGAAGG - Intergenic
1139294136 16:65885431-65885453 ATGGATGGGCAGCAAATGGGTGG + Intergenic
1139380866 16:66529823-66529845 ATGGATGGGCAGAGGATGGATGG - Intronic
1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG + Intergenic
1139908485 16:70382021-70382043 TTGCAAGGGCTGCAAAGGGAAGG - Intronic
1140118894 16:72066434-72066456 TTGCTTGGGCAGCAAATGTTTGG - Intronic
1140359169 16:74330300-74330322 ATGAATGGGCAAAAAGTGGAGGG - Intergenic
1140504206 16:75460169-75460191 TTGCATGGAGAGTAGATGGAAGG - Intronic
1140658907 16:77168361-77168383 TTGGAAGGGAAGAACATGGAAGG + Intergenic
1141096775 16:81168485-81168507 GTGGATGGGTGGAAAATGGATGG + Intergenic
1143387502 17:6540449-6540471 TTCCGTGGGGAGAAAATGGTTGG + Intronic
1146237456 17:31180642-31180664 CTGAATGGGCAAAAACTGGAAGG + Intronic
1146776444 17:35622057-35622079 TTGCATGTGAAGCACATGGAAGG + Intronic
1148676476 17:49448507-49448529 ATGCATGGGCAGGAAGTGAAAGG + Intronic
1149603818 17:57910984-57911006 TGGCATAGGGAGAAAATGGGAGG - Intronic
1150977876 17:70109329-70109351 TTTCATGGGCATAAAATGCCTGG + Intronic
1156740939 18:40327043-40327065 TTGAAAGGGCAGGAGATGGATGG - Intergenic
1156907035 18:42365553-42365575 TTGCATGGATAGGAAATGGTAGG + Intergenic
1157876040 18:51274716-51274738 TTCACTGGGCAGACAATGGAAGG - Intergenic
1158485090 18:57859094-57859116 TTGGCAGGGCAGAAGATGGAAGG - Intergenic
1159705850 18:71686116-71686138 CTGAATGGGGAAAAAATGGAAGG + Intergenic
1159748980 18:72277045-72277067 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1160163742 18:76493697-76493719 TTGCAGGGGAAGAAACTGGAGGG - Intronic
1160364079 18:78309376-78309398 TTGGAGGCGCAGACAATGGAAGG - Intergenic
1162311574 19:9910877-9910899 ATGGATGGAGAGAAAATGGATGG + Intronic
1162872545 19:13597571-13597593 TTGGATGGCTGGAAAATGGATGG + Intronic
1165144896 19:33724700-33724722 TAGGATGGGGAGAAAAGGGAAGG - Intronic
1165773873 19:38393874-38393896 TTCCCTGGGCAGAAAAGGGGAGG + Intronic
1166562332 19:43741323-43741345 TTGCATCGGCAGAAAGTAGGTGG + Intronic
1167634213 19:50644616-50644638 TTGAATGGATAGAAGATGGATGG + Intronic
925921233 2:8639283-8639305 TAGTATGGGCTGAGAATGGAGGG - Intergenic
926148949 2:10413995-10414017 TTGCATGGGCAGCAGAGGGGAGG - Intronic
927005653 2:18845449-18845471 TCATATGGGCAGAAAGTGGAGGG - Intergenic
929095536 2:38260255-38260277 TTGCAGGGCCTGAAAATGCAAGG - Intergenic
929694570 2:44103313-44103335 GTGCCTGGGCAGGAAATAGAGGG + Intergenic
932836230 2:75040528-75040550 GTGGATGGGTAGGAAATGGATGG - Intergenic
933702135 2:85263187-85263209 TTGGCTGGCTAGAAAATGGATGG + Intronic
934539658 2:95163244-95163266 TTGGATGGGCACAACAGGGATGG - Intronic
936260827 2:110958657-110958679 TCCCATGGGCAGCAGATGGAAGG + Intronic
937404933 2:121618267-121618289 TTGCTTGGGCTGAAAATCAAAGG + Intronic
937700482 2:124858101-124858123 CTGAATGGGCAAAAACTGGAAGG + Intronic
937834032 2:126453466-126453488 CTGAATGGGCAAAAACTGGAAGG - Intergenic
938651164 2:133385141-133385163 CTGAATGGGCAAAAACTGGAAGG - Intronic
939674326 2:145053260-145053282 ATTCATGGCCAGAAGATGGAAGG - Intergenic
939705157 2:145443602-145443624 TTTCATTGACATAAAATGGATGG - Intergenic
941153744 2:161948797-161948819 TAGCATGGGCAGAATTTGGCTGG - Intronic
941440770 2:165532606-165532628 CTGAATGGGCAAAAACTGGAAGG + Intronic
942218209 2:173743573-173743595 TTTCCTTGCCAGAAAATGGATGG + Intergenic
945351721 2:208788316-208788338 CTGAATGGGCAAAAATTGGAAGG + Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
946456452 2:219830538-219830560 TGGCATGGGCAGATACTGCAGGG - Intergenic
946496313 2:220199392-220199414 TTGCATGGGCACATGATGAAAGG + Intergenic
948045179 2:234938096-234938118 TTCCAGAGACAGAAAATGGAGGG + Intergenic
948648886 2:239426536-239426558 ATGCCTGAGCAGAAACTGGAAGG - Intergenic
1169062082 20:2668153-2668175 GTGAATGAGCAGAATATGGAGGG + Intergenic
1169447930 20:5688052-5688074 TTGCATGAGCAGGAAGGGGAAGG - Intergenic
1169964598 20:11201756-11201778 TTGCATGGAGAGACAGTGGATGG + Intergenic
1170230447 20:14041367-14041389 TAGCAAGGACAGAAAATTGATGG - Intronic
1172179965 20:32996865-32996887 GTGCATGGAGAGAGAATGGATGG - Intronic
1172473075 20:35215216-35215238 TTTAATTGGCAGAAAATGGAGGG - Intergenic
1172813000 20:37663747-37663769 TTATATGGTCTGAAAATGGAGGG - Intergenic
1172880075 20:38194061-38194083 TTGCCTAGGCAGAAAATAAAGGG - Intergenic
1173040749 20:39460180-39460202 TCCCATGGGGAGAAAAGGGAAGG + Intergenic
1174247174 20:49190010-49190032 TTGGATGGGCACTAAAGGGACGG - Intergenic
1174316006 20:49702328-49702350 CTTCATGGGCAGAAAAAGAATGG + Intronic
1174327932 20:49794346-49794368 TTGATTGGCCAAAAAATGGATGG - Intergenic
1174625355 20:51909720-51909742 TTGAATGGCCAAAAAAAGGAGGG + Intergenic
1175594442 20:60219652-60219674 TTCCAAGGGCAGGAAAGGGAGGG - Intergenic
1177257893 21:18689879-18689901 TTGCTTGTGCAGAAAACAGATGG + Intergenic
1177822154 21:26043110-26043132 TTCCATGGGCAGAAGAGGGATGG - Intronic
1178041144 21:28642298-28642320 CTTCATGGGCAGGAACTGGAGGG + Intergenic
1178427462 21:32490507-32490529 TTTGAAGGGGAGAAAATGGAAGG + Intronic
1178427641 21:32491734-32491756 TTTGAAGGGAAGAAAATGGAGGG + Intronic
1178474261 21:32922619-32922641 TGGCATGGGAAGAAGAAGGAGGG - Intergenic
1180599939 22:17009015-17009037 TTGCCTGGGGAGAGAAGGGAAGG + Intergenic
1183801230 22:40166404-40166426 TAGCATGGCCAAAAAATGTAGGG - Intronic
1184509974 22:44927593-44927615 TAGCATTGGCGGAGAATGGACGG - Intronic
1184995082 22:48199471-48199493 TGGCATGGGAGGAAAATGGTCGG + Intergenic
949669083 3:6377429-6377451 TTCCTTGGGCACAAAATGCAAGG - Intergenic
950167254 3:10810812-10810834 GTGCATTGGCACAAAGTGGAGGG + Intergenic
951988982 3:28654429-28654451 ATGCAAGGGCAGAAAAGGAAAGG + Intergenic
952958866 3:38577325-38577347 TTGCAAGGACAGGAAGTGGAGGG - Intronic
953082603 3:39634833-39634855 TTGCCTGGGCAGAATAGTGATGG - Intergenic
953121382 3:40045875-40045897 ATGGATGGGGAGAAAATGAAGGG + Intronic
957092774 3:75748738-75748760 CTGAATGGGCAAAAACTGGAAGG + Intronic
957793317 3:84967636-84967658 TAGCATGGGCAGGGAATGGGAGG - Intronic
958139714 3:89546597-89546619 TTGCAGTGGCAGAAACTGCAGGG + Intergenic
958454128 3:94308744-94308766 TTACCTGGGCAGAAAAAGGAGGG + Intergenic
958456610 3:94339834-94339856 TTTCATGGGCAGAAATAAGAAGG - Intergenic
962743149 3:138377835-138377857 TTGAATGGGCAGAAACTGTGTGG + Intronic
964384775 3:156135999-156136021 CTGCATGAGTACAAAATGGATGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965185311 3:165455107-165455129 TTCTATGGGCACAGAATGGAGGG + Intergenic
965661884 3:171050645-171050667 TTGCATGGGACAAAAATGAAGGG - Intergenic
966364311 3:179166370-179166392 CTTTATGGGTAGAAAATGGAGGG - Intronic
966607426 3:181835305-181835327 TTTCATTGGCACAAAAGGGAAGG + Intergenic
966645357 3:182240537-182240559 TTGTAAGTACAGAAAATGGAGGG + Intergenic
966888866 3:184391798-184391820 TTGAATGGGCATTGAATGGATGG - Intronic
967367483 3:188704109-188704131 TTGCTTGGGGAAAAAATGCATGG + Intronic
967370844 3:188744337-188744359 TTGGATGTGGAGAAAATGAAAGG - Intronic
967378513 3:188831846-188831868 TAGCATACTCAGAAAATGGAGGG - Intronic
969329868 4:6468196-6468218 TTTCCTGGGCAGAAAGTAGATGG + Intronic
970434726 4:16022270-16022292 TTGCCTGGAAAGAAAATGGTTGG + Intronic
971192332 4:24439438-24439460 TAGCAAGTGCAGAGAATGGAAGG - Intergenic
973539087 4:51917627-51917649 GTGGATGGCCAGAAAATGGAAGG + Intergenic
974504183 4:62746899-62746921 CTGAATGGGCAAAAACTGGAAGG + Intergenic
974759466 4:66256365-66256387 CTGAATGGGCAAAAACTGGAAGG - Intergenic
976061681 4:81136157-81136179 TTGAATGGGGAGAACCTGGAAGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977508001 4:97926366-97926388 TTGGATGGGAAGGACATGGAAGG - Intronic
977646624 4:99420022-99420044 TGGCATGGTTAGAAAATTGAAGG + Intronic
977723186 4:100264626-100264648 CTGAATGGGCAAAAACTGGAAGG - Intergenic
978948465 4:114527293-114527315 CTGCTTGGGAAGAAAATGGGAGG + Intergenic
979769706 4:124507809-124507831 CTGCATGAGCAGGAAATGAAGGG + Intergenic
979841707 4:125450214-125450236 TTGCTTGGGAAGAAAGTGGAGGG - Exonic
979896643 4:126166008-126166030 CTGAATGGGCAAAAACTGGAAGG - Intergenic
980373988 4:131918490-131918512 TTTAATTGGCAGAAAATGAAGGG + Intergenic
982010481 4:151101141-151101163 TTCCATGGTCAAAAAATGGCAGG + Exonic
982349043 4:154394642-154394664 AAGCATGGTCAGAGAATGGAAGG - Intronic
982821701 4:159948420-159948442 GAGCAGGGGCAGAAAATGGAAGG + Intergenic
983184448 4:164685458-164685480 TTGGATGGGGAGCAAAGGGAGGG + Intergenic
983864180 4:172743870-172743892 TTGCCTGTGCAGAAGATAGATGG - Intronic
985695625 5:1338596-1338618 TTCCATGGAGAGAAAACGGAAGG - Intronic
987217502 5:15752431-15752453 TTTCATGGGGAGAAAATGTTGGG + Intronic
987709871 5:21492864-21492886 TTTCCGGGGCAGGAAATGGAGGG + Intergenic
987814274 5:22880356-22880378 TTCCATAGGAAGAAAATGTATGG + Intergenic
987984399 5:25127432-25127454 GTGGAAGGGCAGAAAATGGATGG + Intergenic
988749741 5:34181299-34181321 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
989412583 5:41137418-41137440 CTGAATGGGCAAAAACTGGAAGG + Intergenic
990885007 5:60581288-60581310 TTCCAAGGACAGATAATGGAAGG - Intergenic
991152700 5:63389631-63389653 TTGTATGGGCAGAGAAAGAATGG + Intergenic
991738002 5:69644503-69644525 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991760192 5:69911921-69911943 TTTCCGGGGCAGGAAATGGAGGG + Intergenic
991787140 5:70206179-70206201 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991789578 5:70224229-70224251 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991814327 5:70499339-70499361 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991817462 5:70520631-70520653 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991839423 5:70786972-70786994 TTTCCGGGGCAGGAAATGGAGGG + Intergenic
991879586 5:71206569-71206591 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991882026 5:71224598-71224620 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
992583234 5:78203837-78203859 TTGAACAGGCAGAAAATGAATGG - Intronic
993156091 5:84225447-84225469 TTACATGGGAACAAAGTGGAGGG + Intronic
993832754 5:92779821-92779843 CTGCATGGACAGAAAATTAAAGG - Intergenic
994193350 5:96893882-96893904 TGGCATGTTCAGAAAATGGCAGG - Intronic
994460537 5:100064566-100064588 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
994484686 5:100377977-100377999 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
994821280 5:104653466-104653488 TTGCATGGGCACAAATTCAAAGG + Intergenic
996975204 5:129424465-129424487 TTAAATGGGAAGAAAATGAAGGG - Intergenic
997070053 5:130611050-130611072 CTGAATGGGCAAAAACTGGAAGG + Intergenic
997516018 5:134490497-134490519 TTGCATTGACAGATAATGGCGGG - Intergenic
997717756 5:136054723-136054745 TTGTATGGGCATCAATTGGAGGG - Exonic
998741317 5:145205319-145205341 TCACATGGGCTGAAAGTGGAAGG - Intergenic
1001374958 5:171247626-171247648 TGGGGTGGGCAGAGAATGGATGG - Intronic
1001600448 5:172924800-172924822 ATGGATGGACAGAAAATGAATGG - Intronic
1001781561 5:174373410-174373432 TTCCAGGGGCAGAGAATGAAGGG + Intergenic
1001949285 5:175804967-175804989 TTACATGTGAACAAAATGGAGGG - Intronic
1004843789 6:19615482-19615504 TTGCATTGGCAGTTAATGGTGGG - Intergenic
1005753352 6:28903899-28903921 CTGCATGGGAAGGAAAAGGATGG + Exonic
1006672414 6:35737573-35737595 TTCCTAGGGCAGAAAAGGGATGG - Intronic
1007074990 6:39060646-39060668 AGGCATTGGCAGAAGATGGAAGG - Intronic
1007188536 6:39994146-39994168 TTGCATGGCCAGCAAATTCAAGG + Intergenic
1008793349 6:55267849-55267871 TTGCAGGGGCAGAATCAGGAAGG + Intronic
1009459955 6:63900679-63900701 ATCCATCAGCAGAAAATGGAAGG + Intronic
1009745992 6:67816594-67816616 TTACATGGGCAGAATAGGGATGG - Intergenic
1010275584 6:73965192-73965214 TTGCATGAGAAGAAACAGGATGG + Intergenic
1011796056 6:90953543-90953565 TTGCCTATGCAGAAAATTGAAGG - Intergenic
1012159120 6:95860918-95860940 CTGCATTGTCAGAAAATAGAAGG - Intergenic
1013034740 6:106370365-106370387 TAGCATGGGCAGCAACTAGAGGG - Intergenic
1013036886 6:106393512-106393534 CTGCATGGGCAGGGATTGGATGG + Intergenic
1013209707 6:107975385-107975407 TGGAATGGGGAGAAGATGGAAGG + Intergenic
1013350550 6:109301986-109302008 TTACATGGGCAGAAAATTCCTGG - Intergenic
1013515074 6:110877179-110877201 TTACATGTCCACAAAATGGATGG - Intronic
1013871467 6:114766837-114766859 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1015819765 6:137248185-137248207 TTGCTTGAGGAGAAGATGGAAGG + Intergenic
1016829505 6:148419651-148419673 CTCCAAGGGCAGAAAACGGATGG - Intronic
1019779260 7:2929937-2929959 CTGCAGGGGGAGACAATGGAGGG + Intronic
1020503691 7:8956411-8956433 TTGCTTGGCAAGAAAATGTATGG - Intergenic
1021023171 7:15629847-15629869 TTTCTTTGGTAGAAAATGGATGG + Intronic
1022732151 7:33037588-33037610 TTTCATGGACTTAAAATGGAAGG - Intronic
1024120353 7:46230947-46230969 TTACATGGTAAGAAAAAGGAGGG - Intergenic
1024774759 7:52771121-52771143 TTGAAAGGGCAGAGAAAGGAGGG + Intergenic
1027560826 7:79727961-79727983 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1028511825 7:91633843-91633865 ATGCATGAGGAGAAAATGGGTGG + Intergenic
1028564682 7:92216371-92216393 TTTCATGGGGAAAAAATGAAGGG + Intronic
1030368647 7:108673121-108673143 TGGCCTGTGCAGAAAATGGATGG + Intergenic
1030463800 7:109874512-109874534 GTGCAGGGGCAGGAAGTGGATGG + Intergenic
1031225820 7:119036553-119036575 TTGTATGGGTAGAAGATGCAAGG - Intergenic
1031603269 7:123739268-123739290 TTGCTTGGGCAGATAGTGGATGG - Intronic
1031851659 7:126872128-126872150 TTGCATGTGCATAGGATGGAAGG + Intronic
1035495057 7:159317451-159317473 ATTTATGGGCAGAAAATGGAAGG - Intergenic
1035891109 8:3344263-3344285 TGGCATTGGCAGAAAGTGCATGG - Intronic
1037975068 8:23203368-23203390 TGCCATGGGAGGAAAATGGAAGG + Intronic
1038618683 8:29119397-29119419 CTGCATGGGCTGGAAATGGAAGG + Intronic
1039350523 8:36759081-36759103 TTGCATGGGCAGGAAGGGGAAGG - Intergenic
1039790737 8:40873658-40873680 TTCCATGGGCAGAGCATGGCAGG - Intronic
1043077471 8:75720110-75720132 TTTTATGGGCACAAAATGGGGGG - Intergenic
1043336720 8:79185277-79185299 CAACATGGGCAGAAAAAGGAAGG - Intergenic
1043880389 8:85535793-85535815 TTGAATGGGAAGAGGATGGATGG + Intergenic
1044474076 8:92605843-92605865 TTTGATGGGCTGAAAATGGTCGG - Intergenic
1044984854 8:97748383-97748405 TGGAATAGGGAGAAAATGGAAGG + Intergenic
1045726682 8:105182135-105182157 CTGAATGGGCAAAAACTGGAGGG - Intronic
1046502966 8:115102079-115102101 TAGCACAGGAAGAAAATGGATGG + Intergenic
1046542094 8:115598727-115598749 TTTGATGGGCAGAAAATACAAGG + Intronic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1047580547 8:126210190-126210212 CTGAATGGGCAAAAGATGGAAGG - Intergenic
1047711199 8:127554189-127554211 TTGGATGGGGAGAAGATGCAAGG - Intergenic
1047883122 8:129218385-129218407 TTTTATAGGCACAAAATGGAGGG - Intergenic
1049168297 8:141140868-141140890 TTACAAGGGGAGAAAATGCAGGG - Intronic
1049350636 8:142162657-142162679 ATGGATGGGCAGAGGATGGATGG + Intergenic
1052021117 9:23526221-23526243 GTGCGTGGCCTGAAAATGGAGGG + Intergenic
1052742427 9:32405998-32406020 GTGCAAAGGCAGAAAAAGGACGG - Intronic
1053041221 9:34874290-34874312 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1054806868 9:69404008-69404030 TTGCATGGGCAGGAAAGGGGTGG + Intergenic
1056138199 9:83649366-83649388 TTGCAGTGGCTCAAAATGGATGG + Intergenic
1056666996 9:88589097-88589119 TTCTGTGGGCAGAAAAGGGATGG - Intergenic
1058117381 9:101099522-101099544 ATACATGGGGAGAAAAAGGATGG + Intronic
1058846622 9:108966804-108966826 TAATATAGGCAGAAAATGGATGG + Intronic
1060370693 9:123067877-123067899 TTCTATAGGTAGAAAATGGAGGG - Intronic
1060586944 9:124792556-124792578 TGGCAGGGGCAGATCATGGAGGG + Intronic
1061344009 9:130007364-130007386 TTGGATGTGCAACAAATGGAAGG + Intronic
1061417524 9:130455188-130455210 ATGCATGGGTAGATGATGGATGG - Intronic
1203357935 Un_KI270442v1:179562-179584 TTGAATGGGCAAAAACTGAAAGG + Intergenic
1186025454 X:5305911-5305933 TTACATGGGTAGAAAAAGCAAGG - Intergenic
1186622538 X:11256604-11256626 TGGTAGGGGCAGAAAATGAACGG + Intronic
1189139540 X:38587249-38587271 GTGAATGGGGAGAAAATGTAAGG - Intronic
1190145872 X:47891343-47891365 TGGCCTGTGCAGAAAATAGATGG - Intronic
1191784768 X:64905530-64905552 TTGCATGAGCAGTAAAAGGTGGG + Intergenic
1192973437 X:76257471-76257493 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1193965692 X:87983355-87983377 GTGCATGTGCAAAAAAGGGAAGG - Intergenic
1194079270 X:89438233-89438255 TTGCATAGGCAGAATAGGCAAGG + Intergenic
1194189102 X:90812639-90812661 TTTCATGAGCTGAAAATAGAAGG + Intergenic
1196338014 X:114561919-114561941 TTGCATAGCCTGAAAAGGGAAGG + Intergenic
1196974794 X:121147530-121147552 CTGCCTCAGCAGAAAATGGAAGG + Intergenic
1197044334 X:121977590-121977612 TGGCCTGTGCAGAAGATGGATGG + Intergenic
1199186881 X:144925559-144925581 TTGAATGGGCAAAAGCTGGAAGG + Intergenic
1200431888 Y:3093539-3093561 TTGCATAGGCAGAATAGGCAAGG + Intergenic
1200535682 Y:4394536-4394558 TTTCATGAGCTGAAAATAGAAGG + Intergenic
1200813802 Y:7511028-7511050 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1201238641 Y:11936234-11936256 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1201464854 Y:14269361-14269383 CTGAATGGGCAAAAACTGGAAGG - Intergenic