ID: 1128436945

View in Genome Browser
Species Human (GRCh38)
Location 15:67662044-67662066
Sequence TTCCACAGTTTGGAAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128436945 Original CRISPR TTCCACAGTTTGGAAATAAC TGG (reversed) Intronic
900230979 1:1557533-1557555 TTCCAAAGTTTTGAGATTACAGG - Intronic
902626814 1:17681556-17681578 TTCCACAGTCTGGAATTGCCTGG + Intronic
902723316 1:18318894-18318916 TCCTACAATTTGGGAATAACCGG - Intronic
903395161 1:22996119-22996141 TTCCACATTTTGGAGAAATCAGG - Intergenic
903899430 1:26632730-26632752 TTCCAAAGTTTGGAGAAACCAGG - Intergenic
906829202 1:49013812-49013834 TTTCACAGTTTGGAAGTACATGG + Intronic
907226345 1:52950784-52950806 TATCACAGTTTGGGAATGACTGG + Exonic
907578140 1:55547147-55547169 TTCCACAGCTTGGAAGTTACAGG - Intergenic
908922902 1:69217534-69217556 TTCAACATTCTGGAAATAATTGG - Intergenic
909260217 1:73478890-73478912 TTCCACATTTGCGAAATAGCTGG + Intergenic
909780583 1:79541471-79541493 TTACAAAGTCAGGAAATAACAGG - Intergenic
911469348 1:98297861-98297883 GTACACAGGTTGGAAATCACAGG + Intergenic
911501323 1:98688851-98688873 TTCCAAACTGTAGAAATAACTGG - Intronic
911699572 1:100936100-100936122 TGCCAGAGTTTGAAAATCACTGG - Intronic
912004606 1:104881895-104881917 TTCCTCTCTTTGGAACTAACTGG - Intergenic
912765099 1:112401792-112401814 ATGCAGAGTTTGGAAATAACTGG - Intronic
913031865 1:114915214-114915236 TTTAACAATTTGGAAATAAAAGG + Intronic
913270602 1:117089428-117089450 TTCCAAAGTGTGGAGATTACAGG - Intronic
914873086 1:151491772-151491794 TTCCAAAGTGTGGGAATTACAGG + Intergenic
916416720 1:164599213-164599235 TTACACAATTTAGAAAGAACTGG - Intronic
917872694 1:179256057-179256079 TTCCACAGTTAGGATATCACTGG - Intergenic
918985739 1:191623022-191623044 TTCAAAAGTCTGGAAACAACAGG - Intergenic
919166497 1:193901609-193901631 TTACACTGGTTGTAAATAACCGG + Intergenic
920577670 1:207073544-207073566 TTCCACATTTGGGAAAAAAATGG - Exonic
923402321 1:233627269-233627291 AGCCACAGCTTGTAAATAACAGG + Intronic
924069031 1:240256478-240256500 TCCCAAAGTGTTGAAATAACAGG - Intronic
924646567 1:245883233-245883255 TTATACAGTTTGGAAAAAATAGG - Intronic
1063042083 10:2352472-2352494 TTCCACATTGTGACAATAACTGG - Intergenic
1063351460 10:5360060-5360082 TTCAGCAGTTTGGATATAATGGG - Intergenic
1065387210 10:25145609-25145631 TGCTACAGTTTGGATAAAACTGG - Intergenic
1065391704 10:25189116-25189138 TTCAAAAGTCAGGAAATAACAGG + Intronic
1068346521 10:55786820-55786842 TTTCACACTTTGCAAATGACTGG + Intergenic
1068678172 10:59789572-59789594 TTTAACAATTTGGAAATAAAAGG + Exonic
1073477838 10:103765946-103765968 TTCCACAGTTTGGGCAAGACTGG - Intronic
1073531366 10:104235188-104235210 TTCCAAATTTTGGAAAAATCAGG - Intergenic
1073775352 10:106779195-106779217 TTTGACATTTTGGAAATAATGGG + Intronic
1074225637 10:111481551-111481573 TCCCAAAGCTTAGAAATAACTGG + Intergenic
1074873793 10:117598361-117598383 GTCCACAGTGTGGTAATAACTGG - Intergenic
1075520507 10:123141012-123141034 TTACAAAGTCGGGAAATAACTGG + Intergenic
1079487010 11:20945689-20945711 TTCCATTGATTGGTAATAACTGG + Intronic
1079820270 11:25118201-25118223 TTCCACTGTTGGGAAGTAAATGG - Intergenic
1080138350 11:28885006-28885028 TTAAAAAGTTAGGAAATAACAGG + Intergenic
1080333221 11:31166334-31166356 TTTCACAGCATTGAAATAACTGG - Intronic
1081404602 11:42681821-42681843 TTCCATCATTTGGAAATTACAGG + Intergenic
1082263700 11:50097372-50097394 TTCCAAAGTTTTGAGATTACAGG - Intergenic
1085138964 11:74122310-74122332 TACCACAGTTTGGAAGAAGCAGG - Intronic
1085242594 11:75071197-75071219 TTCCTCAGTTTGTAGATGACAGG + Intergenic
1085715842 11:78872483-78872505 TGGCACACTTGGGAAATAACAGG - Intronic
1087017644 11:93569895-93569917 TTCCACAGTTTGAAAATACGAGG + Intergenic
1088488819 11:110367104-110367126 TTCCACAGTTAAGAAATCAAAGG + Intergenic
1088510277 11:110566474-110566496 TTCCACAGTTAGGAAGTGGCAGG - Intergenic
1090153972 11:124417007-124417029 ATCCAAAATTTGGAAATAGCTGG + Intergenic
1091143516 11:133257247-133257269 TTGCACAGTTTTGAAATTATAGG - Intronic
1091254849 11:134174130-134174152 TTCCAAAGTGTGGGAATTACAGG - Intronic
1093789075 12:23226063-23226085 TTCCCCAGTTGTAAAATAACAGG - Intergenic
1093797627 12:23332058-23332080 TGTTACAGTTTGGAGATAACTGG - Intergenic
1093857867 12:24127598-24127620 TGCCACAGTGTGGGAATAAAAGG + Intergenic
1094369691 12:29724568-29724590 TTACACAGCTGGGAAATGACTGG + Intronic
1094416194 12:30217732-30217754 ATCCACAGTTGGGAAAAACCAGG - Intergenic
1096344819 12:50836571-50836593 TTCAACAGTTTGGGAGGAACAGG - Intergenic
1099051215 12:77783590-77783612 TTTCCCCATTTGGAAATAACTGG - Intergenic
1101319779 12:103663461-103663483 TTGCCCAGTCTGGAAATGACAGG + Intronic
1101448296 12:104754109-104754131 TTTCCCAGCTTGGAAATAACTGG - Intronic
1101593361 12:106141456-106141478 TTACACAGTTTGTAAATGGCAGG + Intergenic
1102093781 12:110218426-110218448 TTCCATAGTTTAGACATCACTGG + Exonic
1102748778 12:115273637-115273659 TTCCAGAGTTTGCAAACCACAGG - Intergenic
1102942973 12:116960564-116960586 TTATTCAGTTTGGAAATAAGTGG + Intronic
1104139006 12:125968657-125968679 GAGCACAGATTGGAAATAACAGG + Intergenic
1107007269 13:35627540-35627562 TTACACAGTTTGGGAATCACTGG - Intronic
1108768857 13:53670836-53670858 TTTCACAGTTTGGAAAGAAACGG + Intergenic
1108963690 13:56269819-56269841 ATCCAAAGATTGGAACTAACTGG - Intergenic
1109037406 13:57283526-57283548 GTCAACAGTTTTGAAATAAATGG + Intergenic
1110048622 13:70863517-70863539 TACCACAGTTTGAAAATTGCAGG - Intergenic
1110304108 13:73964956-73964978 TTCCATAGTGTGAAAATAATTGG - Intronic
1110912644 13:80982779-80982801 TTCAAAAGTCTGGAAACAACAGG - Intergenic
1114192872 14:20453761-20453783 TCCCAAAGTGTGGAAATTACAGG - Intronic
1114857728 14:26469857-26469879 TTCCAAAGTGTTGAAATTACAGG + Intronic
1114893824 14:26960581-26960603 TTCCACTGTTGGTAAATAAAGGG - Intergenic
1115749857 14:36478521-36478543 TTCCAAAGTATAGAAATAATTGG + Intronic
1116176974 14:41483558-41483580 TTCCCCACTTTGGAGATAAAAGG + Intergenic
1117483362 14:56170552-56170574 TTACACAGTTAGGAAATGTCAGG - Intronic
1119286068 14:73456635-73456657 ATCCACAGTTTGAAAAACACAGG + Intronic
1119368456 14:74116342-74116364 TTCAACATTTGGGAAATACCAGG + Intronic
1120410863 14:84153832-84153854 TTCAACAGTTTGAAAATTACTGG + Intergenic
1122664958 14:103322822-103322844 TTGCCCAGGTTGGAAATAAGTGG + Intergenic
1124480261 15:30073306-30073328 TTCAACACTTTGAATATAACAGG + Intergenic
1126122267 15:45264207-45264229 ATCTACAGTTTGAAAATAAGTGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127001568 15:54514329-54514351 TTCCACTGTAAGGAAAAAACTGG - Intronic
1128436945 15:67662044-67662066 TTCCACAGTTTGGAAATAACTGG - Intronic
1128621146 15:69151045-69151067 GTCCAAAGTCTGGAAATGACTGG + Intergenic
1131647871 15:94364952-94364974 TTCCAGAATGTGGAAATAAATGG + Intronic
1131738361 15:95359006-95359028 TTCCACAGCTTGGAAAGGAATGG - Intergenic
1131806807 15:96131022-96131044 TTGCACAGTTAGGAAGCAACTGG + Intergenic
1132376373 15:101330782-101330804 TGCCACAGTTTATAAATCACAGG + Intronic
1133073103 16:3259808-3259830 TTCCAAAGTGTTGAAATTACAGG - Intergenic
1133816412 16:9200800-9200822 TTCTACACTTTGGAAAATACTGG + Intergenic
1134878954 16:17727612-17727634 TTCCACAGTGTTGAGATTACAGG - Intergenic
1135190806 16:20352984-20353006 TTCCATAGTTAGAAATTAACTGG + Intronic
1135893435 16:26377153-26377175 TACCACAGTCTGGAATTTACTGG + Intergenic
1135987812 16:27196964-27196986 TCCCACAGTGCTGAAATAACAGG + Intergenic
1136525801 16:30829460-30829482 TGCCACAATTTGGAACTAAGAGG + Intergenic
1138303289 16:55950655-55950677 TTCCAGAAATTGGAAATAAGAGG + Intronic
1138935668 16:61718971-61718993 TTTTACAGTTTTGAAATAATTGG - Intronic
1139599657 16:67979044-67979066 TCCCACAGTGTGGAGATTACAGG - Intronic
1140537562 16:75724607-75724629 TTCCAAAGTCAGGAAACAACAGG + Intronic
1140538754 16:75735491-75735513 TTCCAAAGTCAGGAAACAACAGG - Intronic
1140707345 16:77643094-77643116 TTTCAGAGTTTGGAAATTAAAGG - Intergenic
1143207569 17:5155631-5155653 TTCTAGAGTTTGGAAACCACAGG - Intronic
1147833287 17:43312217-43312239 TCCCACAGTGTGGGAATTACAGG - Intergenic
1149872785 17:60198213-60198235 TTCTAGAGTTTGGAAACCACAGG + Intronic
1150031813 17:61745625-61745647 TTCCACAGTGCTGAAATTACAGG + Intronic
1150598044 17:66624326-66624348 TTTCAGAGTCTGGAGATAACTGG - Intronic
1154362873 18:13678590-13678612 ATCAACAGTTTAGAAATAAGTGG - Intronic
1155508330 18:26551385-26551407 TTGGACAGTTTGCAAACAACGGG + Intronic
1155737470 18:29241503-29241525 TTCCACTGTTGGCAAATAAGAGG - Intergenic
1156418745 18:36927486-36927508 TTCCAAAGTGTTGAAATGACAGG - Intronic
1156914192 18:42446497-42446519 TTCCATTGTTTGGCAATTACAGG - Intergenic
1158091552 18:53720236-53720258 TTCCTGAGTTTGAAAACAACTGG - Intergenic
1162012214 19:7824214-7824236 TCCCAAAGTTTTGAGATAACAGG - Intergenic
1163087121 19:14989714-14989736 TCCCAAAGTTTTGAAATTACAGG - Intronic
1164326181 19:24194164-24194186 ATCCACAGATAGGAAAAAACTGG + Intergenic
1164775721 19:30852091-30852113 TTCCACAATTTGGGATAAACAGG - Intergenic
1166845593 19:45726081-45726103 TTCCAAAGTGTTGAAATTACAGG - Intronic
1167925069 19:52814626-52814648 TCCCAAAGTTTTGAAATCACAGG - Intronic
925573205 2:5333217-5333239 TTACACAGTTTGCAAAACACTGG - Intergenic
925675113 2:6353987-6354009 TTCCAGATTGTGGAAATCACTGG + Intergenic
925848937 2:8061582-8061604 TTCCACCGTACAGAAATAACAGG + Intergenic
927121953 2:19973804-19973826 TTCCACATTTTTAAAAAAACAGG + Intronic
928052096 2:28009647-28009669 CACCACAGTTTTGAAAGAACTGG + Intronic
929177320 2:38993417-38993439 TTCCAAAGTGTTGAAATTACAGG + Intronic
929337315 2:40764675-40764697 TTCCACATTGTGGCAATAACAGG - Intergenic
930305378 2:49668780-49668802 TTCCACAGTTTGAACAAAACTGG + Intergenic
930695150 2:54403670-54403692 ATCCACCATTTGGAAAAAACAGG + Intergenic
930749854 2:54923987-54924009 TTCCATTGTGTGGATATAACAGG + Intronic
930785146 2:55264489-55264511 TCCCACAGTGTTGAAATTACAGG + Intronic
932237808 2:70135111-70135133 TTCCAAAGTGTTGGAATAACAGG + Intergenic
932653369 2:73584645-73584667 TTCCATAGTTTGGAGGGAACAGG + Intronic
933325807 2:80835477-80835499 TTCCACAAGTGGTAAATAACAGG - Intergenic
933830237 2:86201143-86201165 CTCAACAGTTTGGCAATATCAGG - Intronic
933937058 2:87215040-87215062 TTACACAATTGGGAAAAAACAGG - Intergenic
936356083 2:111750784-111750806 TTACACAATTGGGAAAAAACAGG + Intergenic
937765201 2:125652898-125652920 TTAAACAGTTAGGAAATAAGTGG - Intergenic
938738478 2:134208163-134208185 GTCCAAAGTTTGGAAAATACTGG - Intronic
938765420 2:134457947-134457969 TTCCCCAGTCAGGAAATGACAGG - Intronic
939534193 2:143405045-143405067 TTCCAAAGTATGAAAATAATAGG + Intronic
939631867 2:144535298-144535320 TTGCCCAGTTTGGAAAAAAAGGG + Intergenic
940016864 2:149115643-149115665 TTTCACAGTTTAGAACTATCTGG + Intronic
943604098 2:189956042-189956064 TTCTCTATTTTGGAAATAACAGG + Intronic
944343706 2:198635195-198635217 ATTCACAGTTTGGGAATATCTGG + Intergenic
946005581 2:216521902-216521924 TTCCACTGATTGGAAATAAGGGG + Intronic
946092570 2:217242784-217242806 TACCAAAGTTTGGGAATTACTGG + Intergenic
946466377 2:219915522-219915544 TGCACAAGTTTGGAAATAACTGG + Intergenic
1169934483 20:10868432-10868454 TTCAAAAGTTTGGTAATACCTGG + Intergenic
1169947432 20:11004216-11004238 TTCCACAGTTTGTCCATTACAGG + Intergenic
1172410216 20:34715912-34715934 TTCCACAATCTTGATATAACTGG - Intronic
1174826900 20:53776703-53776725 TCCCAGAGTGTGGAAATTACAGG - Intergenic
1182875931 22:33690982-33691004 TTCCAGAGCTAGGAAATAACTGG - Intronic
1183383385 22:37501665-37501687 TCCCACAGTTGGGAAGTACCAGG - Intronic
949497363 3:4645197-4645219 TGGCAGAGTTTGGAAATAAATGG - Intronic
950709284 3:14803501-14803523 TTCCAGGGAATGGAAATAACAGG + Intergenic
951564129 3:23995745-23995767 TTCCACAGTAAAGAAATAAAGGG - Intergenic
952242537 3:31547397-31547419 TCCCAAAGTGTGGAAATGACAGG - Intronic
956249656 3:67222380-67222402 TACCCCAGTTTGGAAATCAATGG + Intergenic
957849491 3:85788559-85788581 TTCCAGAGTATGCATATAACAGG + Intronic
958159044 3:89792617-89792639 AACCACATTTTGGAAATAAGAGG - Intergenic
958475415 3:94574684-94574706 TGCCACAGTCAGGAAACAACAGG - Intergenic
958780525 3:98536195-98536217 TTCCTAACTTTGGATATAACTGG - Intronic
959396527 3:105845796-105845818 TTCTAAAGTTTGGAAATGAAGGG - Intronic
959827142 3:110811728-110811750 TTACACAGTTTGTAATTAATAGG + Intergenic
959917834 3:111837782-111837804 TTCCACAGTCCTGAAATTACAGG - Intronic
959924641 3:111907748-111907770 TTCCAAAGTTTGGGGATTACAGG + Intronic
961182983 3:124890569-124890591 TTCAACAGTTTGTAAAGCACTGG - Intronic
961802546 3:129463320-129463342 TACCAGGGTTTGGAGATAACTGG - Intronic
961860109 3:129909976-129909998 TATCACAGTTTGAAAATCACTGG + Intergenic
962152930 3:132912040-132912062 AAACACAGTTTGGAAATTACAGG - Intergenic
962548094 3:136457835-136457857 TCCCAAAGTTTGGAGATTACAGG - Intronic
964695313 3:159501306-159501328 TTCTAAAGTTTGGAAACAAAAGG + Intronic
964806067 3:160611063-160611085 GCCCACAGTATGAAAATAACAGG + Intergenic
965919897 3:173900282-173900304 TTCCAATGATTGGAATTAACTGG + Intronic
966515198 3:180812476-180812498 TTGGACAGTTTGGACAGAACTGG - Intronic
966890446 3:184403849-184403871 TTCCAAAGTGTTGAAATTACAGG + Intronic
967061349 3:185875573-185875595 TTCCAAAGTTTTGAGATTACAGG + Intergenic
969419830 4:7086510-7086532 TTCCAAAGTTTGGAGAAATCAGG + Intergenic
970336898 4:15056643-15056665 TTCCATGGTTTGGAAAACACTGG + Intronic
970785310 4:19789814-19789836 TTCCAGAGTTAGAAAATAAATGG + Intergenic
971874963 4:32296795-32296817 TTCCAAAGTTTTGATATTACAGG - Intergenic
972890036 4:43546666-43546688 TCCCAAAGTGTGGAAATTACAGG - Intergenic
973280693 4:48357955-48357977 TTCCACAGTATTGGAATTACAGG + Intronic
973618125 4:52701179-52701201 TTCCAAATTTTGGAAAAATCAGG - Intergenic
974313829 4:60250684-60250706 TTCCACATTTTGGAAAGAGGAGG - Intergenic
974462263 4:62203667-62203689 TTTCTCAATTTGGATATAACAGG - Intergenic
975617786 4:76264852-76264874 TTCCAAAGTGTGGAGATTACAGG + Intronic
977124448 4:93147435-93147457 TTCCAAAGTTTGAAATTAAAAGG - Intronic
977794264 4:101143568-101143590 TTTGACAGTTAGGAAGTAACTGG - Intronic
979000387 4:115210023-115210045 TTCAACAGTTTTGGAAGAACAGG - Intergenic
979801677 4:124917370-124917392 TCCCATATTTTGGAATTAACAGG - Intergenic
980340698 4:131541958-131541980 TTTCAGATTTTAGAAATAACAGG + Intergenic
980932063 4:139191679-139191701 TTCCAAATTCTGGAAAGAACAGG - Intergenic
982384461 4:154785443-154785465 TTCTACATTTTGGATAAAACGGG + Intronic
982866797 4:160523474-160523496 TTCCCAAGTGTGGAAATAAAGGG + Intergenic
984561141 4:181272098-181272120 ACTCACAGGTTGGAAATAACAGG - Intergenic
986640245 5:9864789-9864811 TTCCAGAGATTGGAAGTGACAGG + Intergenic
986720956 5:10561536-10561558 TCCCAAAGTTTTGAAATTACAGG + Intergenic
988864646 5:35321619-35321641 TTCCCCAATTTGGGAATATCTGG - Intergenic
991085135 5:62641954-62641976 TTCCACAGTGGGAAAAAAACAGG - Intergenic
991111484 5:62904905-62904927 TTTCACAGGGTTGAAATAACAGG - Intergenic
991301043 5:65129404-65129426 TCCCAAAGTTTGGGAATTACAGG + Intergenic
991580506 5:68149911-68149933 TTCCAGAGTGGGGAAGTAACTGG + Intergenic
994229831 5:97300301-97300323 TTCAACAGTCAGGAAACAACAGG - Intergenic
996454063 5:123659693-123659715 CTTCACAGTTCTGAAATAACAGG + Intergenic
997141826 5:131389746-131389768 TTCCACAATTTGGAAGGAACCGG - Intronic
997990458 5:138541252-138541274 TCTCACATTTTGGGAATAACTGG + Intronic
998413812 5:141930692-141930714 TGCCACACTTAGGAAAGAACAGG + Intronic
999217880 5:149950793-149950815 TTACACAGTTAGCAAATAACAGG - Intergenic
999510304 5:152243363-152243385 CATCACAGTTTGGAAATAAATGG + Intergenic
999813866 5:155155816-155155838 TTTCACAGTTGAGAAATAAAGGG + Intergenic
1000695068 5:164370454-164370476 TCCCACAGTTTAGATATCACTGG - Intergenic
1001082619 5:168678222-168678244 ATCCACAGTTTGAAAAACACTGG - Intronic
1001872777 5:175171186-175171208 TTCCACATTTGGAAAATAAGGGG - Intergenic
1004024379 6:11804965-11804987 TGCCTTAGTTTGGAAACAACAGG - Intronic
1004950312 6:20662936-20662958 GTCCACAGTTAGGAAATTGCTGG + Intronic
1005167869 6:22946355-22946377 ATCCACAGTTTGGGAAATACTGG - Intergenic
1005394011 6:25362774-25362796 TCCCAAAGTGTGGAAATTACAGG - Intronic
1008147240 6:47906759-47906781 TTGCACAGTTTGGATATAAGGGG + Intronic
1008273244 6:49514570-49514592 TTCCAAAGTATTGAAATTACAGG - Intronic
1012604429 6:101140410-101140432 TTTCAAAGTTTTGAAATCACAGG + Intergenic
1013428511 6:110035743-110035765 TCCCACAGTGTTGGAATAACAGG - Intergenic
1013501899 6:110760467-110760489 TCCCAAAGTTTTGAATTAACAGG - Intronic
1014045913 6:116886585-116886607 TTCCTAAGTTTTGAAATAACTGG + Intronic
1014988806 6:128048250-128048272 CTCCACAGTTTCTAAATCACTGG - Intronic
1015235840 6:130970321-130970343 TTCCACAGTTTTCCAATGACAGG - Intronic
1016488108 6:144565723-144565745 TTCCACAGCTTGGACATTCCTGG + Intronic
1016754710 6:147671806-147671828 TGCCACATTTTGAAAATTACTGG + Intronic
1017502150 6:155035477-155035499 TCCCAAAGTTTGGGATTAACAGG + Intronic
1017726712 6:157281323-157281345 TCCCAAAGTTTGGGAATTACAGG - Intergenic
1020709317 7:11586502-11586524 TTCCTCACTTTTGAAATAAAAGG - Intronic
1021159984 7:17261011-17261033 TTCCACTGTTTAAAAACAACTGG - Intergenic
1021625530 7:22589496-22589518 TTCAACAGTTAGGAAGGAACTGG - Intronic
1021951013 7:25774917-25774939 TCACACAGTTTGCCAATAACTGG + Intergenic
1022303770 7:29127262-29127284 TTCAACAGTTTTGAAATAGAAGG + Intronic
1022772997 7:33494510-33494532 TACCACAGGTTGTAAATAACTGG - Intronic
1024792202 7:52979404-52979426 TTCAACAGTCTGGAAATATTGGG - Intergenic
1025154545 7:56592544-56592566 ATCCACAGATAGGAAAAAACAGG + Intergenic
1025763395 7:64416365-64416387 ATCCACAGATAGGAAAAAACAGG - Intergenic
1027139961 7:75649962-75649984 TTCCACAGATTTGACATCACAGG + Intronic
1028385868 7:90252407-90252429 TCCCAAAGTTTTGAAATTACAGG - Intronic
1029800587 7:102943102-102943124 TTCCACATTTTGAAAACATCTGG - Intronic
1030519453 7:110579754-110579776 CTCCACATTTTGGAAAGTACAGG + Intergenic
1031050371 7:116938752-116938774 TTGGACATTTTGGAAACAACTGG - Intergenic
1032260967 7:130336984-130337006 TGCCTCACTTTGGAAATCACTGG + Intergenic
1032294028 7:130618539-130618561 TTCCACATTCTAGAATTAACAGG + Intronic
1032635923 7:133708707-133708729 TTACACAGCTTGTAAGTAACTGG + Intronic
1036295702 8:7535062-7535084 AGCCACTGTTTGGATATAACAGG - Intergenic
1036326865 8:7785957-7785979 AGCCACTGTTTGGATATAACAGG + Intergenic
1036402989 8:8426886-8426908 GGCCACAGTTCGGAAATACCAGG + Intergenic
1037156934 8:15712959-15712981 TTTAACAGCATGGAAATAACTGG - Intronic
1037982596 8:23265107-23265129 TTCTACAGATTGGAAATTACAGG + Intergenic
1039346186 8:36708247-36708269 TTCCACAGTTTTAAAATGAAAGG - Intergenic
1039744587 8:40412901-40412923 TTCTCCATTTTGAAAATAACTGG - Intergenic
1042340517 8:67674083-67674105 TTCTACAGTTGTGAAATAGCTGG + Intronic
1042528719 8:69793503-69793525 TTCCAAAGTGTTGAGATAACAGG - Intronic
1044212687 8:89568388-89568410 TTCCAGAGTTTTGAAGCAACTGG - Intergenic
1045389622 8:101702486-101702508 TCCCAAAGTGTGGAAATTACAGG + Intronic
1046368365 8:113268644-113268666 TTCCACAGTTTTAAAGTAAATGG + Intronic
1046421873 8:113996605-113996627 TTCAATATTTTGGAAATACCAGG - Intergenic
1047571210 8:126100402-126100424 TTCTCCAGTTTGGAAGTAAGGGG + Intergenic
1047803903 8:128338761-128338783 GTCCCCAGCTTGGAAATTACTGG + Intergenic
1050828894 9:9986244-9986266 TTCCACATCTAGGAAATAACTGG + Intronic
1051167506 9:14280030-14280052 TGACACACTTTGGAAATGACAGG + Intronic
1051377813 9:16421766-16421788 TTCCACATTCTTGTAATAACTGG - Intronic
1051864426 9:21663539-21663561 GTGCACAGTTTTCAAATAACTGG - Intergenic
1052558163 9:30047646-30047668 TTACAGTGTTTGTAAATAACTGG - Intergenic
1054767476 9:69054256-69054278 TTCCAAAGTTTTGGGATAACAGG + Intronic
1056119347 9:83471888-83471910 TTACATAGTTAGGAAATGACAGG - Intronic
1056370062 9:85944892-85944914 TACCACAGTTTGAAAACCACAGG + Intronic
1058662316 9:107277928-107277950 TTCCAAAGTGTTGAAATTACAGG + Intergenic
1058993425 9:110276195-110276217 TCCCAAAGTTTTGAAATTACAGG - Intergenic
1060641772 9:125244892-125244914 TTCCAAAGTGTGGGAATTACAGG + Intergenic
1060788595 9:126469944-126469966 TTCCACAGTTTAGAAAAGAGAGG - Intronic
1061348335 9:130043757-130043779 TTTCAGAGATTGGAAATCACTGG - Intergenic
1062189648 9:135241369-135241391 TTCCACATTATAAAAATAACAGG + Intergenic
1189078417 X:37942716-37942738 TTCTAAATCTTGGAAATAACAGG + Intronic
1191964844 X:66746706-66746728 TGTTACAGTTTGGAGATAACTGG - Intergenic
1192864841 X:75120235-75120257 TTCCAAATTTTGGAAAAATCAGG - Intronic
1193181159 X:78458018-78458040 TTCCACATTTTGGAGAAATCAGG + Intergenic
1198741315 X:139846219-139846241 TTCACCAGGTTGGAAACAACTGG - Intronic
1199932958 X:152543542-152543564 TTCCACAATTTGGGAATAAGAGG - Intergenic
1200259405 X:154604385-154604407 TTCCAATGTTTTGAAAGAACAGG + Intergenic
1200292990 X:154889170-154889192 TTCGACAGTGTGGAAGTAATGGG + Intronic
1200339838 X:155384902-155384924 TTCGACAGTGTGGAAGTAATGGG + Intergenic
1200346632 X:155455786-155455808 TTCGACAGTGTGGAAGTAATGGG - Intergenic
1201681936 Y:16655601-16655623 TTAAAAAGTTAGGAAATAACAGG - Intergenic
1202273030 Y:23088614-23088636 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202292996 Y:23332068-23332090 TTACACAGCTTGGAAATGAGAGG + Intergenic
1202426027 Y:24722358-24722380 TTACACAGCTTGGAAATGAGAGG - Intergenic
1202444762 Y:24947728-24947750 TTACACAGCTTGGAAATGAGAGG + Intergenic