ID: 1128438304

View in Genome Browser
Species Human (GRCh38)
Location 15:67677916-67677938
Sequence CCTCAATGGCAGTTATTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128438304_1128438309 29 Left 1128438304 15:67677916-67677938 CCAGGCAATAACTGCCATTGAGG 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1128438309 15:67677968-67677990 AAGGCCTTTGCAAGAATATTTGG 0: 1
1: 0
2: 0
3: 17
4: 219
1128438304_1128438308 10 Left 1128438304 15:67677916-67677938 CCAGGCAATAACTGCCATTGAGG 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1128438308 15:67677949-67677971 ATGCTGTTTAATTTTATTTAAGG 0: 1
1: 0
2: 4
3: 93
4: 1108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128438304 Original CRISPR CCTCAATGGCAGTTATTGCC TGG (reversed) Intronic
900388067 1:2419624-2419646 CCTCACTGGCTCTTCTTGCCCGG + Intergenic
903383154 1:22910378-22910400 GCTCAATGGCATTGATTACCTGG - Exonic
904877614 1:33668566-33668588 CCACAATGGCTGTTTTGGCCTGG - Intronic
911044445 1:93617056-93617078 CCTCAATGCCAGTTTTTCCTTGG + Intronic
913494356 1:119414634-119414656 CCTCAATTGCAATTTTTCCCTGG - Intergenic
916734058 1:167591473-167591495 CCTTAATGGCAGTGATGGCAAGG - Intergenic
919759638 1:201089371-201089393 CATCAATGGCAGTGAGTGCCGGG - Exonic
922477478 1:225916590-225916612 CCTCAATGCCAGCTCTTGCAGGG + Intronic
924814440 1:247429600-247429622 CCTCACTTCCAGTTTTTGCCGGG + Exonic
1075102154 10:119514058-119514080 CCTAAATGGTAGTTAGGGCCAGG + Intronic
1081114518 11:39183432-39183454 CCTGAATTTCAGTTATTACCTGG + Intergenic
1083757803 11:64800943-64800965 GCTCAATGGCAGTGATGCCCAGG + Exonic
1093893931 12:24555958-24555980 CCTCACTGTCAGTCATTGGCTGG - Intergenic
1105580977 13:21695639-21695661 CCTTAATGGGAGTTGTTGCAAGG - Intronic
1118697609 14:68399852-68399874 ACTCTATGGCAGTTTTTTCCAGG + Intronic
1122429747 14:101632804-101632826 CCTCAATGCTAGATAATGCCAGG - Intergenic
1124188278 15:27549114-27549136 CATCAATGTAAGTTACTGCCTGG - Intergenic
1128438304 15:67677916-67677938 CCTCAATGGCAGTTATTGCCTGG - Intronic
1130626008 15:85516059-85516081 CTTTAATGGCAGTTATTCCTAGG - Intronic
1130669944 15:85902803-85902825 ACTCAATGGTAGTGATTTCCAGG - Intergenic
1139010056 16:62620976-62620998 CCTCAATGAAAGCTATGGCCTGG - Intergenic
1143312633 17:6005155-6005177 TTTTAATGGCAGTTATTCCCTGG + Intronic
1143667975 17:8375367-8375389 CATCACAGCCAGTTATTGCCAGG - Intronic
1144377681 17:14661700-14661722 CCTCATTGGCAGTGATTCTCAGG + Intergenic
1147124173 17:38354159-38354181 CCACAATGGCAGTTACTACAAGG - Intronic
1153598355 18:6752683-6752705 GCTCAAAGTCAGTTCTTGCCTGG + Intronic
1164265436 19:23611775-23611797 CCTCAATGTCAATTATTATCAGG - Intronic
1165303206 19:34985779-34985801 CATCAATGGCAGCAAGTGCCAGG + Intergenic
1168573700 19:57490948-57490970 CCCCAATGGCACTGACTGCCAGG - Intronic
927193208 2:20531241-20531263 CCAGCAAGGCAGTTATTGCCAGG + Intergenic
928673393 2:33625924-33625946 CATCAATAGCAGCTTTTGCCAGG - Intergenic
929636052 2:43521645-43521667 CCTGAATAGCAGCTATAGCCTGG - Intronic
946677241 2:222173661-222173683 CCTAAAAGACAGTTAATGCCAGG + Intergenic
1171370605 20:24659701-24659723 TGTCAAGGGCAGGTATTGCCCGG - Intronic
1173694291 20:44995191-44995213 TTTCTATGGCAGTTATTCCCAGG - Exonic
1175276750 20:57775914-57775936 TTTAAAAGGCAGTTATTGCCAGG - Intergenic
949750491 3:7347052-7347074 CCTCAAGGGCATTTTTTTCCTGG - Intronic
951522669 3:23624020-23624042 ACACAATGGCAGTCAATGCCTGG - Intergenic
956184967 3:66553621-66553643 CCTGAATGGCAGTAATTGGCTGG - Intergenic
957813834 3:85265072-85265094 ACTCACTGGCAGATATTGCTGGG + Intronic
960786404 3:121377241-121377263 CCTGAATGGAAGTTCTGGCCAGG - Intronic
961422797 3:126819545-126819567 CCTCCATGGCAGTCATTGCCTGG - Intronic
961760250 3:129161930-129161952 CCTAAGTGGCACTTTTTGCCTGG - Intergenic
961934335 3:130567313-130567335 CAGCAATGTCAATTATTGCCAGG - Intronic
962391983 3:134980037-134980059 CCTCAATGGTAGTTTTTGACAGG + Intronic
962867749 3:139461730-139461752 CCTCCATGGCAGTGCTTGGCTGG + Intronic
970579486 4:17461861-17461883 TCTCAAAGGCAGTGACTGCCAGG + Intronic
973108230 4:46367437-46367459 CCTCCGTGACAGTAATTGCCAGG - Intronic
975737722 4:77397934-77397956 CCTCAAATGCAGTTGTGGCCTGG + Intronic
976449757 4:85174596-85174618 TTTCAATGGCAATTATTTCCTGG + Intergenic
980987084 4:139705843-139705865 CCTGAAGTGCAGTTATTGTCTGG + Intronic
984932228 4:184858009-184858031 CCTCATTGGCAGTCATGGCCAGG + Intergenic
985957106 5:3274134-3274156 CCCTAATGGCACTTATTCCCAGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991503056 5:67296580-67296602 CCTCAATGTCAGTTATTTGCAGG - Intergenic
994092673 5:95822694-95822716 CCTCAGTTGCAGGTATTGCTTGG + Exonic
997745952 5:136300598-136300620 CCCCAATGCCAGTTCTGGCCTGG - Intronic
1000277509 5:159751595-159751617 CCTCAATGGGCGTGACTGCCTGG - Intergenic
1000387077 5:160684908-160684930 CCTTGATGGCAGTGACTGCCAGG + Intronic
1001156982 5:169281085-169281107 GCTCTATGGCAGTAATTGACTGG - Intronic
1012626088 6:101404517-101404539 CCCCAATTACATTTATTGCCTGG + Intronic
1014474302 6:121853912-121853934 TTTCAATGGCAGTTATCTCCTGG - Intergenic
1017833584 6:158155240-158155262 TCTCAATGGCAGTGATTGACAGG - Intronic
1023288456 7:38643889-38643911 CACCCATGGCAGTTAATGCCTGG - Intergenic
1027358713 7:77385668-77385690 CCTCAATTCCAGATATGGCCTGG - Intronic
1027989508 7:85339115-85339137 CCTCAATTTCAGTTCTTGCATGG + Intergenic
1032564987 7:132932522-132932544 CATGAATGGCAGTGATTGGCTGG - Intronic
1034497025 7:151429123-151429145 CCTCATAGGCAATTAATGCCTGG - Intronic
1037698398 8:21248825-21248847 ACGCACTGGCAGTTAGTGCCAGG + Intergenic
1038909448 8:31946632-31946654 CCTGAATGGCACTTATTTTCAGG + Intronic
1040815263 8:51501207-51501229 ACCCAAAGGCAATTATTGCCAGG - Intronic
1045335414 8:101198605-101198627 CCTGACTGGCAGTTAGAGCCAGG + Intronic
1046149108 8:110200476-110200498 CTTCCATGGCAGTTACTGTCTGG + Intergenic
1049801965 8:144522099-144522121 GCTGGATGGCAGTTGTTGCCGGG - Exonic
1058236423 9:102496297-102496319 ACTCAAGGGCAGTTATTCCTGGG + Intergenic
1059599179 9:115757652-115757674 GCTAAATAGCAGTTATTTCCTGG - Intergenic
1060733797 9:126053643-126053665 CCCCAAGGGCAGGTGTTGCCAGG - Intergenic
1062544291 9:137054666-137054688 CCTCAAGGGTAGTTCTGGCCTGG - Intergenic
1187140638 X:16590050-16590072 GCTCAGTGGCAGATAGTGCCTGG - Intronic
1189243193 X:39541431-39541453 CCTCAAGGGCAGAAAATGCCTGG - Intergenic
1194897011 X:99455321-99455343 CCTTACTGGCAGTTATTGAAGGG + Intergenic
1199335412 X:146613784-146613806 CCTCAGTTGCAGTGATAGCCTGG + Intergenic
1200344968 X:155439197-155439219 CCTCAATGGCAAAGATTGCTGGG - Intergenic
1200692761 Y:6323617-6323639 CCTCTTTGGCAGTCACTGCCTGG - Intergenic
1200953597 Y:8923887-8923909 CCTCAATGGCAGTTGTTCAGTGG + Intergenic
1201042511 Y:9851109-9851131 CCTCTTTGGCAGTCACTGCCTGG + Intergenic
1201492741 Y:14560246-14560268 CCTTCATAGCATTTATTGCCTGG + Intronic