ID: 1128438855

View in Genome Browser
Species Human (GRCh38)
Location 15:67683674-67683696
Sequence AGCTTGAACCTGGGCATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23415
Summary {0: 1, 1: 4, 2: 82, 3: 1831, 4: 21497}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128438847_1128438855 15 Left 1128438847 15:67683636-67683658 CCTGTAATCCTAGCTACTCAGGA 0: 2479
1: 61175
2: 150793
3: 234901
4: 202389
Right 1128438855 15:67683674-67683696 AGCTTGAACCTGGGCATTGGAGG 0: 1
1: 4
2: 82
3: 1831
4: 21497
1128438849_1128438855 7 Left 1128438849 15:67683644-67683666 CCTAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1128438855 15:67683674-67683696 AGCTTGAACCTGGGCATTGGAGG 0: 1
1: 4
2: 82
3: 1831
4: 21497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128438855 Original CRISPR AGCTTGAACCTGGGCATTGG AGG Intronic
Too many off-targets to display for this crispr