ID: 1128443034

View in Genome Browser
Species Human (GRCh38)
Location 15:67731259-67731281
Sequence CTGTGTCACCAGCAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 493}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128443034_1128443038 4 Left 1128443034 15:67731259-67731281 CCCTCTTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 55
4: 493
Right 1128443038 15:67731286-67731308 TACCCAGTGAGGTCGCAGAGAGG 0: 1
1: 0
2: 2
3: 6
4: 105
1128443034_1128443042 8 Left 1128443034 15:67731259-67731281 CCCTCTTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 55
4: 493
Right 1128443042 15:67731290-67731312 CAGTGAGGTCGCAGAGAGGGAGG 0: 1
1: 1
2: 1
3: 23
4: 317
1128443034_1128443043 16 Left 1128443034 15:67731259-67731281 CCCTCTTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 55
4: 493
Right 1128443043 15:67731298-67731320 TCGCAGAGAGGGAGGAGTGTTGG 0: 1
1: 0
2: 1
3: 26
4: 279
1128443034_1128443046 29 Left 1128443034 15:67731259-67731281 CCCTCTTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 55
4: 493
Right 1128443046 15:67731311-67731333 GGAGTGTTGGGAAGATACTAGGG 0: 1
1: 0
2: 0
3: 17
4: 172
1128443034_1128443039 5 Left 1128443034 15:67731259-67731281 CCCTCTTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 55
4: 493
Right 1128443039 15:67731287-67731309 ACCCAGTGAGGTCGCAGAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 204
1128443034_1128443045 28 Left 1128443034 15:67731259-67731281 CCCTCTTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 55
4: 493
Right 1128443045 15:67731310-67731332 AGGAGTGTTGGGAAGATACTAGG 0: 1
1: 0
2: 0
3: 15
4: 215
1128443034_1128443037 -7 Left 1128443034 15:67731259-67731281 CCCTCTTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 55
4: 493
Right 1128443037 15:67731275-67731297 GACACAGTGTGTACCCAGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 133
1128443034_1128443044 17 Left 1128443034 15:67731259-67731281 CCCTCTTCCTGCTGGTGACACAG 0: 1
1: 0
2: 3
3: 55
4: 493
Right 1128443044 15:67731299-67731321 CGCAGAGAGGGAGGAGTGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128443034 Original CRISPR CTGTGTCACCAGCAGGAAGA GGG (reversed) Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
900601386 1:3504191-3504213 CTGTGTGACCAGCATGACCATGG - Intronic
901089637 1:6632745-6632767 CTGCATCACCAGCAGGAAGGCGG - Intronic
901345401 1:8536241-8536263 CTGTTTCTCCATCAGTAAGATGG - Intronic
901371743 1:8804693-8804715 CATTCTCACCAGCAGGAAGGAGG - Intronic
901429392 1:9203710-9203732 CTGTGTCCCAAGCAGGATGCGGG - Intergenic
901627277 1:10631409-10631431 CTGTGTTCCCAGCATTAAGAAGG - Intergenic
901750951 1:11408038-11408060 CTTTGTCAGCAGCATGAAAACGG + Intergenic
901814968 1:11788724-11788746 CAGTTACAGCAGCAGGAAGATGG + Exonic
901915063 1:12492733-12492755 ATGTGCCATCAACAGGAAGATGG + Intronic
904576462 1:31508096-31508118 CTCTTTAACCACCAGGAAGAAGG - Intergenic
905099732 1:35509109-35509131 CTGTGGCACAGGCAAGAAGAAGG + Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906130201 1:43451303-43451325 CTGTGTCTCCTGCAGGGAGAGGG + Exonic
906369715 1:45242322-45242344 CTTTGTCAGCAGCATGAAAATGG - Intronic
906918100 1:50033425-50033447 ATGTGGCACCAGCAGAAAAAGGG + Intergenic
907078509 1:51599922-51599944 CTGTGTCCTCACCTGGAAGAAGG + Intronic
907553344 1:55323454-55323476 CAGAGTCTCAAGCAGGAAGAAGG - Intergenic
908039603 1:60094950-60094972 CTCTCTCCCCAGCAGGTAGAAGG + Intergenic
908067270 1:60420461-60420483 GTGTCTCAGCAGCAGGAAGGTGG + Intergenic
908374690 1:63523351-63523373 CTGTTACACCAGCAGGAAATAGG - Intronic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
909043090 1:70676879-70676901 CCTTGTGACCTGCAGGAAGATGG + Intergenic
911504824 1:98735914-98735936 CACTGTCACCTGCAGAAAGAAGG - Intronic
912190976 1:107339989-107340011 CTGTGGCAACAGCAGGGAGGAGG + Intronic
914985173 1:152450090-152450112 CAGTGGCACCACCAGCAAGAAGG - Intergenic
915047356 1:153029548-153029570 CTTTGTCAGCAGCATGAAAATGG - Intergenic
915101740 1:153506024-153506046 CTTTGTCAGCAGCATGAAAACGG - Intergenic
916361990 1:163980642-163980664 ATGTTTCATCAGCAGCAAGATGG + Intergenic
916387983 1:164298578-164298600 GTATGGCCCCAGCAGGAAGAGGG + Intergenic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
916804265 1:168243465-168243487 CTGTGCAGCCAGCAGGAAGTAGG + Exonic
916852130 1:168714212-168714234 CAGACTCACCAGCAGGAATATGG + Exonic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
918436256 1:184516466-184516488 CTTTGTCAGCAGCATGAAAATGG - Intronic
918633401 1:186746888-186746910 CTTTATCAGCAGCATGAAGATGG + Intergenic
919991498 1:202710665-202710687 CTGCTTCCCCAGCAGGAAGGCGG + Intergenic
920099637 1:203508788-203508810 CTTTGTCACCCGCAGGGAGAAGG - Exonic
920326740 1:205170835-205170857 CTGTGCTCCAAGCAGGAAGAAGG - Intronic
920766549 1:208839172-208839194 CTGTGTCATCATTAGGAAGATGG + Intergenic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921935640 1:220793902-220793924 ATGTGGCAGGAGCAGGAAGAAGG + Intronic
922050989 1:221990508-221990530 GTGTGTCACCAGCAAAGAGAGGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922493281 1:226035966-226035988 CTCTGTGAGCAGCAGAAAGAAGG - Intergenic
923005878 1:230049295-230049317 CTATTTCCCCAGCAGCAAGAGGG + Intergenic
923219477 1:231880231-231880253 CAGTGTCCCCAACAGCAAGAAGG + Intronic
923276238 1:232399427-232399449 CTTTGTCATCAGCAGGAATCAGG - Intronic
923295227 1:232588027-232588049 CTTTATCAGCAGCAGGAAAACGG + Intergenic
923461096 1:234210273-234210295 CTTTATCAGCAGCATGAAGATGG + Intronic
924498560 1:244614040-244614062 CAGAGTCCCCACCAGGAAGATGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062818593 10:517690-517712 ACGTGTCACCAGCAGAAAGATGG + Intronic
1062919764 10:1271034-1271056 CTGTGTGACCAGCTGGGATATGG + Exonic
1063250951 10:4273973-4273995 CTGTGTCTCCAGCTTAAAGATGG + Intergenic
1063558422 10:7102970-7102992 CTGAGTCACCACCTGGAAGAAGG - Intergenic
1063885077 10:10569163-10569185 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1064691968 10:17927567-17927589 CAGATTCACCAGCAGGAAGTGGG + Intergenic
1065137761 10:22689216-22689238 GTGTGTCACAAGCATGGAGATGG - Intronic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1065363395 10:24910850-24910872 CTGTCTCCTTAGCAGGAAGATGG - Intronic
1065886946 10:30087049-30087071 CTATCTCACTAGCAGGAATAAGG - Intronic
1065971582 10:30810128-30810150 CCGTCACCCCAGCAGGAAGATGG - Intergenic
1066095921 10:32071968-32071990 CTGTGTAACCCGCAGGGAGAGGG - Intergenic
1066547068 10:36511184-36511206 GTGAGTCCCCAGCGGGAAGACGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1068480203 10:57579904-57579926 CTGTACCATCAGCAGGAAAATGG - Intergenic
1068812783 10:61275397-61275419 CTGTGTCTCCAGCTTGCAGAAGG - Intergenic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1069830553 10:71279884-71279906 CTGTGGCTCCTGCAGGAAGTAGG - Exonic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1070845702 10:79521337-79521359 CTGTGTCATCAGGCAGAAGAAGG - Intergenic
1070891316 10:79943892-79943914 CCAAGTCAGCAGCAGGAAGATGG + Intronic
1071090803 10:81915763-81915785 CTGTCTCCTCAGCAGGTAGAAGG - Intronic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1072414115 10:95232586-95232608 CTGTGTCCCCAAGAGGTAGACGG - Intergenic
1072957120 10:99897036-99897058 CTGTGTCACCCGCATTAGGATGG - Intronic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075485934 10:122822141-122822163 CTGTGTCCCCAGCACCTAGAAGG - Intergenic
1075674749 10:124288631-124288653 CTGTGTCAGCACCACGAAGCTGG + Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1076666988 10:132098859-132098881 CTGTCTCTCCAGGAGGAAGGAGG - Intergenic
1077615263 11:3669531-3669553 CTGTTTCCTCAGCAGGAATATGG + Intronic
1078139205 11:8679751-8679773 GCATGTGACCAGCAGGAAGAGGG - Intergenic
1078851138 11:15165017-15165039 CTGTATCAGCAGCATGAAAATGG + Intronic
1080916567 11:36666319-36666341 CTGTCCCAACAGCAGGAAAACGG + Intergenic
1081437397 11:43041849-43041871 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1082229036 11:49741953-49741975 CTGTCCCATCAGCAGGAAAATGG - Intergenic
1082901279 11:58255971-58255993 CTGTGTCTGCAGCAGTGAGAGGG + Intergenic
1082998107 11:59268629-59268651 CTTTTTCACCAGCACGGAGAAGG + Intergenic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1084352467 11:68612289-68612311 CTGTATAACCAGCAGGTATAAGG + Intronic
1084367385 11:68711498-68711520 CTCTGTCAGCAGCAGGACTATGG - Intronic
1085022318 11:73217576-73217598 CTAGGACAGCAGCAGGAAGAAGG + Intergenic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1086772906 11:90791426-90791448 CTGCGTCAGCAGCATGAAAATGG + Intergenic
1086810994 11:91309976-91309998 CTGTTTCACCATCAGAAACATGG + Intergenic
1087587660 11:100142212-100142234 CTGGGTCACCAGCTTGCAGATGG + Intronic
1087800587 11:102499024-102499046 ATCTTGCACCAGCAGGAAGAAGG - Intergenic
1088778189 11:113107451-113107473 CTTTATCACCAGCATGAAAAGGG - Intronic
1089170822 11:116510367-116510389 CTGGGACACCAGCAGGCAGTAGG - Intergenic
1090229513 11:125091552-125091574 CTGTTTCATCATCAGGAAAATGG + Intergenic
1090402571 11:126458493-126458515 CTTGGGCACCAGCAGGAAGAGGG - Intronic
1090660369 11:128877932-128877954 CTCTGTCCCCAGCAAGCAGAGGG + Intergenic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1091302801 11:134518291-134518313 ATGTGTCACCAGCAGTGACATGG + Intergenic
1091553348 12:1553630-1553652 CTGTGGCCCCAGGAGGAAGCTGG + Intronic
1091757358 12:3062913-3062935 CTGTGAGGCCAGCAGCAAGATGG - Intergenic
1092763352 12:11829382-11829404 CTGTTTCTCCAGCGGTAAGATGG - Intronic
1094638999 12:32255101-32255123 GGCTGTCACAAGCAGGAAGAGGG - Intronic
1095147817 12:38751264-38751286 CTTTGTCAGCAGCATGAAAATGG + Intronic
1095600523 12:44007958-44007980 CTCTATCACCAGCATGAAAATGG + Intronic
1095640046 12:44477076-44477098 CTGTCTTATCAGCAGGAAAATGG + Intergenic
1096171394 12:49473907-49473929 CTTTATCAGCAGCAGGAAAACGG - Intronic
1096448157 12:51713533-51713555 CATTGCCACCGGCAGGAAGAGGG - Intronic
1096684354 12:53277938-53277960 CTTTGCCACCAGCTGGTAGAGGG - Exonic
1097298188 12:57989753-57989775 CAGTGTAACAGGCAGGAAGATGG + Intergenic
1098200104 12:68045254-68045276 CTGTCTCACCAACATGATGATGG - Intergenic
1098527201 12:71499723-71499745 CTGTTACCCCAGGAGGAAGAGGG + Intronic
1098599976 12:72319156-72319178 CTGTGTCATCAGCAGTCAGCTGG - Intronic
1098750601 12:74289102-74289124 CTGTCTCAGCAACAAGAAGAAGG + Intergenic
1099813444 12:87615706-87615728 CTGTCACACCAGCAGAATGAAGG - Intergenic
1099879198 12:88446289-88446311 CTTTATCAGCAGCAGGAAAAAGG - Intergenic
1099946216 12:89247701-89247723 CTGTTTTTCCAACAGGAAGAAGG - Intergenic
1100875159 12:98954038-98954060 CATTGTCACCACCTGGAAGATGG + Intronic
1100965082 12:100004346-100004368 CTGAGTCCCCACCAGTAAGAAGG + Intergenic
1101576829 12:106005121-106005143 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1101649058 12:106658515-106658537 CTGAGCCACAAGGAGGAAGAAGG - Intronic
1102069136 12:110003107-110003129 ATGTCTCACCATCAGTAAGAAGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102570088 12:113822275-113822297 CTGTGCCAGCACCAGGCAGAGGG - Intronic
1102609402 12:114098185-114098207 CTGAGCCACCTGGAGGAAGATGG + Intergenic
1104110784 12:125702262-125702284 CTGTGTCCCCACCAGGTGGAGGG + Intergenic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104531761 12:129578631-129578653 CTGGGTCACCAGCTTGCAGATGG - Intronic
1105809980 13:23986410-23986432 ATGTGTTATCTGCAGGAAGAGGG + Intronic
1105853139 13:24353456-24353478 CTGGGTCTCCAGCTGGCAGATGG - Intergenic
1108528041 13:51302583-51302605 CTGAGTTACAGGCAGGAAGAAGG - Intergenic
1110559867 13:76899260-76899282 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1110792054 13:79597284-79597306 CTTTGCCAAAAGCAGGAAGAGGG + Intergenic
1110851049 13:80245387-80245409 CTCTGTCACCAACAGGATGAAGG + Intergenic
1110899313 13:80800617-80800639 CTCTGTCACCAGGATGAGGATGG + Intergenic
1110953388 13:81522184-81522206 TTGTCTCACCAGCAGGAAAATGG - Intergenic
1111046041 13:82814048-82814070 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1111555206 13:89871836-89871858 CTTTGTCACCAGGACGAGGATGG - Intergenic
1111946244 13:94668715-94668737 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1112159579 13:96853675-96853697 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1112225711 13:97537942-97537964 CAGTGTCAACAGCCTGAAGATGG + Intergenic
1112555641 13:100466189-100466211 ATGTCTCACCAGCAGGATTACGG - Intronic
1112586963 13:100727172-100727194 CTTTGTCATCAGCATGAAAATGG + Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114812692 14:25918404-25918426 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1115305487 14:31929747-31929769 CAGTGTTACCAGCAGGATTAAGG - Intergenic
1116659110 14:47685068-47685090 GTGTGTCAGCAGCAGGTAGGGGG - Intergenic
1118210048 14:63757551-63757573 CTGTGTAAGCAACAGAAAGAGGG - Intergenic
1119124785 14:72115598-72115620 CTGGCTCACCAGCAGGCTGAGGG - Intronic
1119454764 14:74745397-74745419 CTTTATCACCAGCATGAAAACGG - Intergenic
1120484994 14:85102319-85102341 CTTTATCACCAGCATGAAAACGG - Intergenic
1120887392 14:89462571-89462593 CAGAGTCCCCATCAGGAAGAAGG - Intronic
1122025433 14:98872551-98872573 ATCTGTCCCCGGCAGGAAGAAGG + Intergenic
1122756634 14:103985512-103985534 CTTTATCAGCAGCATGAAGATGG + Intronic
1122852828 14:104546175-104546197 CTGCTTCAGCTGCAGGAAGACGG - Intronic
1122863104 14:104591377-104591399 CTGTGTCCCCAGCAGAAGGTGGG - Intronic
1122953379 14:105058689-105058711 CTGTGTCACCCACAGCATGAGGG + Intronic
1124511172 15:30327215-30327237 CTTTGTCAGCAGCATGAAAACGG + Intergenic
1124731742 15:32203550-32203572 CTTTGTCAGCAGCATGAAAACGG - Intergenic
1125245134 15:37627765-37627787 CTGAGTTACCAGGAAGAAGATGG + Intergenic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1129297663 15:74608804-74608826 CTCTGTCACCAGCTGGCTGAGGG - Intronic
1129609212 15:77039530-77039552 CTGTTTCAGCATCAGTAAGATGG + Intergenic
1130036681 15:80367495-80367517 CTGTCTCATCAGCAGGAAAATGG + Intronic
1130795223 15:87200807-87200829 CTGTGATAGCAGCATGAAGATGG + Intergenic
1131449869 15:92530402-92530424 CTGCTTCCTCAGCAGGAAGAAGG + Intergenic
1131919531 15:97309029-97309051 TTGTGTCCCCATCAGCAAGAAGG + Intergenic
1131931452 15:97447130-97447152 CTGTGTCACAGGAAAGAAGATGG + Intergenic
1132306700 15:100820149-100820171 ATGTGTCAGCTGCAGGAAGCAGG - Intergenic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133544848 16:6796014-6796036 CTTTGTCAGCAGCATGAAAATGG - Intronic
1133952995 16:10413492-10413514 CTTTATCACCAGCATGAAAATGG + Intronic
1134067683 16:11239710-11239732 CTGAGTCCCCACCAGCAAGAAGG - Intergenic
1135201491 16:20441527-20441549 CTGGGTCTCCAGCATGCAGATGG - Intergenic
1135690651 16:24534761-24534783 CTTTGTCAGCAACAGGAAGGAGG + Intergenic
1135841324 16:25879325-25879347 CTGTATCACCAACATGAAAACGG - Intronic
1136079306 16:27841154-27841176 CTGTGTCCTCAGCTGGAAAATGG - Intronic
1137730311 16:50684646-50684668 CTGTGTCCCCCGCATGACGATGG - Intergenic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1137982070 16:53078416-53078438 CTGTGTCATCAGGTGGCAGAAGG - Intronic
1138445170 16:57059004-57059026 CAGTGTCTCCAGCAGGTACAGGG - Exonic
1138512681 16:57517721-57517743 CATGGTCACCAGCAAGAAGAGGG - Intronic
1138899645 16:61253275-61253297 CTTTGTCAGCAGCATGAAAAAGG + Intergenic
1139198777 16:64951010-64951032 CTGTGTTATCTGCAGAAAGAGGG + Exonic
1140388196 16:74561148-74561170 CTCTGACACCAGCAGGAGGAAGG - Intronic
1140654629 16:77126926-77126948 CTTTGTCAGCAGCATGAAAACGG - Intergenic
1141146193 16:81531778-81531800 CCATGTCACCACCAGGAAGGGGG + Intronic
1141814240 16:86398779-86398801 CAGCTTCACAAGCAGGAAGAAGG - Intergenic
1141850603 16:86642726-86642748 ATGTGCCTCCAGCAGGCAGATGG - Intergenic
1141883869 16:86878693-86878715 CTGTGTCCCAAGCAGGAGGCAGG - Intergenic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1142215882 16:88829603-88829625 CTGTGTCCCCAGCAGCCAGTGGG - Intronic
1143739307 17:8941077-8941099 GTGTGTCAGCAGCAGGACAATGG + Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1144678552 17:17177321-17177343 CTGTGACATCAGCAGGTTGAAGG + Exonic
1145193197 17:20866283-20866305 CTCAGGCACCAGCAGGAGGAGGG + Intronic
1145273279 17:21415815-21415837 CTGGGCCACCACCATGAAGACGG - Exonic
1145298819 17:21614804-21614826 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145311468 17:21703259-21703281 CTGGGCCACCACCATGAAGACGG - Exonic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145723300 17:27091542-27091564 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1146656420 17:34637631-34637653 CCGTGGCACCTGCAGGAAGCCGG - Exonic
1148769723 17:50059950-50059972 CTGAGTCACCAGTGGGGAGAGGG + Intronic
1149644319 17:58228729-58228751 GTTAGTCACCAGGAGGAAGATGG - Intronic
1150971365 17:70031940-70031962 CTGTATCAGCAGCATGAAAACGG - Intergenic
1151006939 17:70448818-70448840 ATGTGTCAGCAGCATGAAAATGG - Intergenic
1151195071 17:72425509-72425531 CTGTATCAGCAGCATGAAAATGG + Intergenic
1151997641 17:77620333-77620355 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1152405335 17:80095111-80095133 CTGTGCCGCCAGGAGGAACAAGG - Intronic
1152693718 17:81733654-81733676 CTGTGTCCCCACTAGGAAGCCGG + Intergenic
1152771056 17:82169544-82169566 CTGTGGCTCCAGCAGGGTGAAGG + Intronic
1152988273 18:339167-339189 CTCTGTCACAAGCTAGAAGAAGG - Intronic
1153819068 18:8817313-8817335 CTGTGTCATCATCAGGGAGGTGG + Intronic
1153831826 18:8930506-8930528 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153832234 18:8934050-8934072 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153925154 18:9828978-9829000 CTGTGACAGCAGCAGGTAAATGG - Intronic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155610621 18:27663435-27663457 CTTTATCAGCAGCATGAAGAAGG - Intergenic
1156265736 18:35487311-35487333 CTGTATCAGCAGCATGAAAATGG - Intronic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157661401 18:49448207-49448229 CTGTCTCATCAGCAGGAAAATGG + Intronic
1158403204 18:57139585-57139607 CTGTGTCACCAACAGCAGGCGGG + Intergenic
1158411215 18:57207694-57207716 TTGTGTCAACAGCAGGTAGATGG - Intergenic
1160556875 18:79731133-79731155 ATGTGTCCCCAGGATGAAGAGGG - Intronic
1161168543 19:2801717-2801739 CAGAGTCCCCACCAGGAAGAAGG - Intronic
1161619435 19:5290563-5290585 CTGTGTCACCCGCACGAGGCGGG + Intronic
1161670363 19:5604449-5604471 CTGAGACTCCAGCAGGAAGCTGG + Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
1166785051 19:45362675-45362697 CTGTGTCCCCAGCATGAAGCAGG + Intronic
925478858 2:4248083-4248105 CTTTATCAGCAGCAGGAAAATGG - Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
925896523 2:8476539-8476561 CTGTGCCAACAGCAGGAATGAGG + Intergenic
926195916 2:10763461-10763483 GTGTGTCCCCAGCAGGGTGATGG + Intronic
926307322 2:11647759-11647781 CTTTATCACCAGCATGAAAATGG + Intergenic
926348099 2:11967983-11968005 CTGTGTCACCAGGTATAAGAAGG + Intergenic
926816287 2:16800992-16801014 CTGTGTCTCCAGCATGGAGGAGG - Intergenic
928582663 2:32724819-32724841 CTGTATCAGCAGCATGAAAATGG - Intronic
929816242 2:45234584-45234606 GTTTGTCACCTGCAGGAAGTAGG - Intergenic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
930457352 2:51622314-51622336 CTTTGTCAGCAGCACGAAAATGG - Intergenic
931240319 2:60446514-60446536 ATGTGTCACATGCAGAAAGAGGG + Intergenic
931538194 2:63301280-63301302 CTGTCCCATCAGCAGGAAAATGG + Intronic
933542793 2:83669565-83669587 CTGTGTCAAAAGCAGGAACTAGG + Intergenic
933844727 2:86315971-86315993 TTGTGTGTCCAGCAGAAAGAAGG - Intronic
935190232 2:100771694-100771716 CTGGGTCTCCAGCTGGCAGACGG + Intergenic
935332679 2:101988637-101988659 CTGAGCCACCGGCAGGCAGAGGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936595778 2:113846113-113846135 CTTTATCAGCAGCAGGAAAATGG + Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
939752542 2:146064940-146064962 CTTTATCACCAGCATGAAAAAGG - Intergenic
939847900 2:147269793-147269815 CTTTGTCAGCAGCATGAAGACGG - Intergenic
940196151 2:151096313-151096335 CAGTCTCACCAGCCTGAAGATGG + Intergenic
940462165 2:153978729-153978751 CTTTATCAGCAGCATGAAGATGG + Intronic
941279655 2:163534315-163534337 AGGAGTCATCAGCAGGAAGATGG - Intergenic
942424061 2:175840826-175840848 CTTTGTCAGCAGCATGAAAATGG - Intergenic
943118750 2:183708035-183708057 CTTTATCAGCAGCATGAAGACGG + Intergenic
943386851 2:187211654-187211676 CTTTATCACCAGCAAGAAAATGG + Intergenic
943851099 2:192724090-192724112 CAGAGTCCCCACCAGGAAGAAGG - Intergenic
946088677 2:217199825-217199847 CTCTTTATCCAGCAGGAAGATGG + Intergenic
947248723 2:228078156-228078178 CTGTATCAGCAGCATGAAAATGG + Intronic
947478446 2:230473548-230473570 CTGGATCACCAACAGGAAGTGGG + Intronic
947535630 2:230939167-230939189 CTTTGCCCCCAGCAGGCAGAAGG + Intronic
947795500 2:232891477-232891499 CTGTGTCCCCAGCCAGGAGAAGG - Exonic
948994673 2:241572394-241572416 CTCTGGCAGCAGCACGAAGAAGG - Exonic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1169235164 20:3924803-3924825 CTGTGGTACAAGCAGGAGGATGG - Intronic
1170118707 20:12889032-12889054 CTGTGTCCCCAGCAGAGTGATGG + Intergenic
1170136106 20:13075288-13075310 ATGTGTCACTAGGAGGGAGAAGG - Intronic
1170474900 20:16705240-16705262 CTTTATCAGCAGCATGAAGATGG + Intergenic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1172762511 20:37332394-37332416 ATGTTTCTCCAGCAGGGAGAGGG - Intergenic
1173289087 20:41698702-41698724 CTGTGTCACCAGCAGAATGCAGG + Intergenic
1174409191 20:50322519-50322541 CTGTGTCACCACCCAGTAGAAGG - Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175709110 20:61205169-61205191 CTGTTTCATCAGGAGGATGAGGG + Intergenic
1176179400 20:63742321-63742343 CTGTGTCTCCCGCAGGAGGCAGG + Exonic
1176293134 21:5056624-5056646 CTGTGTCCCCTGCAGGAACGTGG - Intergenic
1176294293 21:5062794-5062816 CTGTGGCACGAGCAGGTAGACGG - Intergenic
1177666104 21:24161719-24161741 CAGAGTCCCCATCAGGAAGAAGG + Intergenic
1178077419 21:29024695-29024717 ATTCGTCACCAGGAGGAAGACGG + Exonic
1178222930 21:30681508-30681530 CCTTGTCACCATCTGGAAGATGG + Intergenic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1179094440 21:38299686-38299708 CTGAGCAACCAACAGGAAGATGG - Exonic
1179176765 21:39013574-39013596 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1179310342 21:40189871-40189893 CTGTATCAGCAGCATGAAAACGG + Intronic
1179862967 21:44200854-44200876 CTGTGGCACGAGCAGGTAGACGG + Intergenic
1179864126 21:44207026-44207048 CTGTGTCCCCTGCAGGAACGTGG + Intergenic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1182537897 22:31019676-31019698 GTGTCCCACCAGCAGGAAGTGGG - Intergenic
1183717727 22:39543666-39543688 CTTTGAGCCCAGCAGGAAGATGG - Intergenic
1183745415 22:39688955-39688977 CTCTGTCACCCACAGGAACAAGG - Exonic
1184372894 22:44093927-44093949 GTGAGTGACCTGCAGGAAGAAGG + Exonic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184783137 22:46658967-46658989 CAGTGCCGCCAGCAGGAAGCAGG + Intronic
1184979426 22:48085471-48085493 CTCAGACACCACCAGGAAGATGG + Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185357730 22:50384637-50384659 CAGTGTCCCCAGCAGCAAGAAGG - Intronic
950450962 3:13065239-13065261 CTGTGTCACCAGCTTGCTGAGGG + Intronic
950525344 3:13519691-13519713 CTGTCTCAGCTGCAGGAACATGG + Intergenic
950659210 3:14456276-14456298 CGCTGTGACCAGCAAGAAGAGGG + Intronic
950787564 3:15449201-15449223 CTTTGTCAGCAGCATGAAAATGG + Intronic
952493795 3:33898197-33898219 CTTTCCCACCAGCAGGAAGGAGG + Intergenic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
953038591 3:39234893-39234915 CTGAGACACCAGCAGCAAGTGGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953876465 3:46669617-46669639 CTGTGACACCCCCAGGAAGGGGG - Exonic
954436990 3:50501508-50501530 CTCTGTCCCCAGCCAGAAGATGG - Intronic
954608888 3:51933893-51933915 CTGTGTCACCAGGTGGCAGGAGG - Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
956210854 3:66799767-66799789 CTATGGGGCCAGCAGGAAGAAGG - Intergenic
956253890 3:67263573-67263595 CAGTGCTACCAGCAGGAACATGG - Intergenic
956641995 3:71424185-71424207 TAGTCTCACCAGCAGCAAGAAGG + Intronic
957527074 3:81391504-81391526 CTTTATCAGCAGCAGGAAAATGG - Intergenic
958525101 3:95246923-95246945 CTTTATCAGCAGCATGAAGATGG + Intergenic
958552515 3:95635454-95635476 CTTTGTCATAATCAGGAAGAGGG + Intergenic
959054344 3:101552892-101552914 CTTTATCAGCAGCATGAAGATGG + Intergenic
959915758 3:111815211-111815233 CTTTGTCAGCAGCATGAAAATGG + Intronic
960242824 3:115365749-115365771 CTGTTTCAACAGTAGGAAAAAGG + Intergenic
960354734 3:116637289-116637311 ATTTGTCACCATGAGGAAGAAGG + Intronic
960558965 3:119061385-119061407 CTCTGACACCAGCAGGAATCCGG + Intronic
961087861 3:124084565-124084587 CTCTTTCACCAGCTGAAAGAAGG + Intronic
961192092 3:124970527-124970549 CTGAGTGGCAAGCAGGAAGAGGG - Exonic
961393213 3:126568995-126569017 CTGTGTCCCCTGGAGGCAGAGGG + Intergenic
961643064 3:128376910-128376932 CTCTGTCACCTGGGGGAAGAAGG + Intronic
961822287 3:129581168-129581190 CTGTGTGAACAGCAGGCAGCAGG - Intronic
964420602 3:156498613-156498635 CTTTATCAGCAGCATGAAGATGG + Intronic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
966986751 3:185187462-185187484 CTGTGTTCCAGGCAGGAAGATGG + Intergenic
968716887 4:2166842-2166864 CTGGGTCTCCAGCTTGAAGAAGG + Intronic
969109525 4:4834716-4834738 CTTTATCACCAGCATGAAAATGG - Intergenic
969234222 4:5853938-5853960 CTGGGTCACCAGCAGGCGAATGG - Intronic
969411799 4:7033452-7033474 CTGTCTCCCCAGCAGGCAGTGGG + Intergenic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
971761229 4:30768388-30768410 TTATGTCACCAGTAGAAAGAAGG + Intronic
972434189 4:39016001-39016023 CTTTGTCAGCAGCATGAAAATGG + Intronic
972732734 4:41811280-41811302 CTTTGTCAGCAGCATGAAAATGG - Intergenic
972857228 4:43121361-43121383 CTTTGTCAGCAGCAAGAAAATGG - Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973386296 4:49516351-49516373 CAGTGTCACCGCCAGGAAGGAGG - Intergenic
973806163 4:54527940-54527962 ATGTGTCACTCCCAGGAAGAGGG - Intergenic
974079410 4:57196694-57196716 CTCTTTCACCAGCATGAAGTAGG + Intergenic
974269463 4:59632389-59632411 CTTTGTCAGCAGCATGAAAATGG - Intergenic
974352786 4:60772182-60772204 CTTTGTCAGCAGCATGAAAATGG - Intergenic
976057255 4:81082502-81082524 CTTTGTCAGCAGCATGAAAAAGG + Intergenic
976444965 4:85119107-85119129 CTTTATCAGCAGCAGGAAAATGG + Intergenic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977868165 4:102056162-102056184 CAGTCTCACCAGTAGGATGAGGG - Intronic
977959637 4:103071412-103071434 CTCTGTCACCAGGCTGAAGAGGG + Intronic
978019113 4:103786441-103786463 CTGTCCCATCAGCAGGAAAATGG + Intergenic
978178141 4:105759580-105759602 CTGAGTCACCAGCAAAAAGAAGG + Intronic
978729859 4:112013096-112013118 CTGGGACACCTGTAGGAAGAAGG + Intergenic
980169090 4:129265334-129265356 GTGTGTCAGGAGCTGGAAGACGG - Intergenic
980642312 4:135596548-135596570 CTGTCCCATCAGCAGGAAAATGG + Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
983123828 4:163924149-163924171 CTGTGTCAACAGCATGAATATGG - Intronic
983291249 4:165808804-165808826 CTTTGTCAGCAGCATGAAAACGG + Intergenic
983741319 4:171138311-171138333 CTTTGTCACCAATAGGTAGAAGG + Intergenic
984315299 4:178122065-178122087 CTATATCTCCAGAAGGAAGAGGG + Intergenic
984568621 4:181362671-181362693 CAGACTCACCAGCAGGAAAAAGG + Intergenic
985049226 4:185972788-185972810 CTGGGGCTCCATCAGGAAGAGGG + Intergenic
1202765719 4_GL000008v2_random:147334-147356 CTATGTCAGCATCAAGAAGATGG + Intergenic
986855939 5:11868813-11868835 CAGAGTCTCCAGCAGCAAGAAGG + Intronic
987137586 5:14914138-14914160 CTGCCTCACCAGCAGGAAATAGG - Intergenic
987721460 5:21638708-21638730 CTTTATCAGCAGCAGGAAAATGG - Intergenic
989637289 5:43549625-43549647 CTTTGTCAGCAGCATGAAAATGG + Intronic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
992122692 5:73610928-73610950 CTGTATCAGCAGCATGAAAACGG - Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
994747254 5:103693634-103693656 CTCTATCACCACCAGGAAGGAGG - Intergenic
995399131 5:111720735-111720757 CTGGGTCTCCAGCTTGAAGATGG + Intronic
996460059 5:123731768-123731790 CTTTGTCAGCAGCATGAAAATGG + Intergenic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000464234 5:161555394-161555416 CTGCTTCACCAGCAGGAGTAAGG - Intronic
1001275078 5:170344915-170344937 CTGTGTGACGAGCAACAAGAAGG + Intergenic
1001884580 5:175277832-175277854 GTGTGTACCCAGCAGGCAGAAGG - Intergenic
1002517613 5:179771255-179771277 CTGTGTGACGAGCAGGGACAGGG + Intronic
1002591699 5:180295152-180295174 CAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1002767979 6:259293-259315 CAGTGTCAGCAGCAGGGAAAGGG - Intergenic
1002802126 6:533669-533691 TTGTCTCACCAGCAGGCAGGAGG + Intronic
1003111145 6:3253112-3253134 CCTGGTCATCAGCAGGAAGAGGG - Intronic
1004443137 6:15672466-15672488 CTGTTTCACCAGCTGACAGATGG - Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1005506939 6:26477687-26477709 CTCTGTCACCAGCAGCCAGAGGG - Intergenic
1006055119 6:31378472-31378494 CTGTAGGACCAGCAGGAACACGG + Intergenic
1006465287 6:34190268-34190290 CTGTCTCATCAGCGGCAAGATGG - Intergenic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1006912347 6:37571602-37571624 CTATGTCCCCAACTGGAAGAAGG + Intergenic
1008499252 6:52164380-52164402 CTTTGTGACAAGGAGGAAGAGGG + Intergenic
1008640549 6:53458139-53458161 CAGTGTCATCAGCTGGAACATGG + Intergenic
1008946363 6:57101374-57101396 CTGTGTCCCATGAAGGAAGAAGG - Intronic
1009901123 6:69808721-69808743 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1010474374 6:76267935-76267957 CTGTATCAGCAGCATGAAAATGG + Intergenic
1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG + Intergenic
1012304431 6:97634544-97634566 CTGAGTCAACACCACGAAGATGG - Intergenic
1013227255 6:108128974-108128996 CTTTATCAGCAGCAGGAAAATGG + Intronic
1013302505 6:108817831-108817853 CTGTGGCTCCAGCATGAAAATGG + Intergenic
1014147529 6:118015222-118015244 CTTTATCAGCAGCATGAAGATGG + Intronic
1014488791 6:122036158-122036180 CTTTATCAGCAGCATGAAGATGG + Intergenic
1014715645 6:124861863-124861885 CTGTATCAGCAGCATGAAAATGG - Intergenic
1014730796 6:125029925-125029947 CTTTGTCAGCAGCATGAAAACGG - Intronic
1014952796 6:127578075-127578097 CTGTGTCATCAGCAGGGAGTGGG - Intronic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1017232524 6:152088679-152088701 CAGAGTCCCCAGCAGAAAGAAGG + Intronic
1017767672 6:157620206-157620228 CAGTGTCCCCATCAGCAAGAAGG - Intronic
1018423269 6:163658443-163658465 CACTGTCAGCAGCAGGGAGAAGG - Intergenic
1018555816 6:165049791-165049813 CTGTAACATCAGCAGGAAAATGG + Intergenic
1019483431 7:1276646-1276668 CTGTGCCCCCAGCAGGGTGATGG + Intergenic
1020259290 7:6521642-6521664 CTGTGTCCCCAGCATGGAGCTGG + Intronic
1020264170 7:6549333-6549355 CTGAGTCACCTGCAGGAAGTAGG - Intronic
1021970873 7:25964805-25964827 CTGCCTCACCAGCAGCAAGGCGG + Intergenic
1022247592 7:28575568-28575590 CGCTGTCTCCAGCAGGAAGGAGG - Intronic
1022260850 7:28703537-28703559 CTGGGTCTCCAGCTGGCAGATGG - Intronic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1023132419 7:37015885-37015907 CTGTGTTACTAGCAGAGAGATGG + Intronic
1024061324 7:45700694-45700716 CTGTGTCACTTGCAGGAGGGAGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024716154 7:52081604-52081626 CTGAGACATCAGCAGCAAGAGGG + Intergenic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1026120250 7:67530399-67530421 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1027687650 7:81296836-81296858 CTTTATCAGCAGCATGAAGATGG + Intergenic
1028351707 7:89857639-89857661 CTGTCCCATCAGCAGGAAAACGG + Intergenic
1028544166 7:91979166-91979188 CTGTATCAGCAGCATGAAAATGG - Intronic
1028754443 7:94419521-94419543 CTGTGGCTCCAGCAGGACCAGGG - Exonic
1028790051 7:94843701-94843723 CTTTATCAGCAGCATGAAGATGG + Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1031043456 7:116862593-116862615 GTTTGTCGCCAGAAGGAAGATGG + Exonic
1031151142 7:118055895-118055917 CTGAGTCACCAGCTTGCAGATGG + Intergenic
1031174933 7:118338289-118338311 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032802780 7:135329741-135329763 CTGTGTCCCCACAAAGAAGAGGG - Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033129975 7:138737461-138737483 CTTTATCACCAGCATGAAAAGGG + Intronic
1033282927 7:140018414-140018436 CTGTGTCACCACCTGTGAGAGGG - Intronic
1033760108 7:144428410-144428432 CTTTATCAGCAGCATGAAGACGG - Intergenic
1033773910 7:144585089-144585111 CTGACTCTTCAGCAGGAAGATGG + Intronic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1034262030 7:149763257-149763279 GTGTGTGCCCAGCAGGAAGGAGG - Intergenic
1034996184 7:155578482-155578504 CTGGGTCTCCAGCATGCAGATGG + Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035112184 7:156492341-156492363 TTGTGTCCCCAGCAGGACGCAGG + Intergenic
1037149366 8:15617029-15617051 CTGTGTAATCAGCAGACAGAGGG + Intronic
1037182414 8:16023766-16023788 CTGTGTCTCCAGCTTGCAGATGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1039073440 8:33667034-33667056 CTTTATCAGCAGCATGAAGATGG - Intergenic
1039190759 8:34971602-34971624 CTGTGTCACTTACAGGAAGAAGG - Intergenic
1040759024 8:50815185-50815207 CTGTGTCTCCAGCTTGCAGATGG - Intergenic
1040797633 8:51303361-51303383 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1041213662 8:55578545-55578567 CTGTTTCACCATCAGCAAAATGG - Intergenic
1041706729 8:60854151-60854173 CTGTGTCATCATCTGCAAGATGG + Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG + Intronic
1042974011 8:74444255-74444277 ATGTGTCAGCAGCAGGGAAAAGG - Intronic
1043357423 8:79429303-79429325 CTGTGTCATCACAAGGCAGAAGG - Intergenic
1044055976 8:87570018-87570040 CTGTGACACCAGCCAGGAGAGGG + Intronic
1045334357 8:101185554-101185576 GTGTGTCAATAGCAGGAAGAAGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1048929171 8:139297264-139297286 CTGTCTCGCCACCAGGGAGAGGG + Intergenic
1049010351 8:139883240-139883262 CAGAGTCCCCAGCAGCAAGAGGG + Intronic
1049184571 8:141242980-141243002 CTCTGTCACCACCCGGTAGATGG - Intronic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1049681707 8:143921622-143921644 CTGCGCCTCCAGCAGGATGAGGG + Exonic
1050160419 9:2713092-2713114 CTGTGGCCCCAGCACTAAGAAGG - Intergenic
1050472641 9:6008273-6008295 CCGTGTCCCCCGCAGGTAGAGGG - Intergenic
1051236256 9:15002464-15002486 CTCTGCCACCATCAGGAAGCTGG + Intergenic
1051698233 9:19791233-19791255 CTGTGTTCCAGGCAGGAAGAAGG + Intergenic
1054144059 9:61549654-61549676 TTGCGTCACCCCCAGGAAGATGG + Intergenic
1055474008 9:76643522-76643544 GTGTGTCACTTGCAGCAAGATGG + Intronic
1055560566 9:77517462-77517484 AGGTATCATCAGCAGGAAGAGGG + Intronic
1055570943 9:77616494-77616516 CTAAGTCAGCAGCAGGAAGATGG + Intronic
1055587401 9:77769515-77769537 CTGTAACACAGGCAGGAAGAAGG + Intronic
1055828895 9:80358116-80358138 CGGGGTCCCCAGCAGGAAGCAGG - Intergenic
1056450915 9:86716013-86716035 CTGTGTCTCCAGCAGGACTGTGG - Intergenic
1056453017 9:86734838-86734860 ATGTTGCCCCAGCAGGAAGAGGG - Intergenic
1056722267 9:89082305-89082327 CCATGTCACCAGCAAGAAGCTGG - Intronic
1056824229 9:89865592-89865614 CTGAGCCACCATCAGGAAGTGGG - Intergenic
1057336547 9:94160150-94160172 CTGGGTCACCAGCTTGCAGATGG - Intergenic
1057868281 9:98698840-98698862 TTCTGTCACCATCAGGGAGACGG + Intronic
1058086872 9:100757052-100757074 CTGTGTCAGCAGCATGAAAATGG + Intergenic
1058758927 9:108110563-108110585 CTGTCTCACGAGCTGCAAGATGG + Intergenic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1059918958 9:119136403-119136425 ATGTCTCACAAGCAGGAACAAGG - Intergenic
1061135139 9:128729453-128729475 CTGTGCCACCATCAGGGAGAAGG - Intergenic
1061254006 9:129443201-129443223 CTGTGCCCCCAGCTGGGAGAAGG + Intergenic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1062171072 9:135135006-135135028 CTGCTTCCCCAGCAGAAAGAAGG - Intergenic
1062668870 9:137694483-137694505 CTGCCTCACAGGCAGGAAGAAGG - Intronic
1185747895 X:2586092-2586114 CTTTGCCGTCAGCAGGAAGAGGG - Intergenic
1188236841 X:27741599-27741621 CCCAGTCACCAACAGGAAGAAGG - Intronic
1188397752 X:29705904-29705926 CTTTGTCAGCAGCATGAAAATGG - Intronic
1189240201 X:39518994-39519016 CTGTGTCACGGGCAGGAGGTCGG - Intergenic
1190583702 X:51915562-51915584 CAGTGTCCCCAGCAGCAAGAGGG + Intergenic
1191041457 X:56085325-56085347 CTGAGTCACCAGCTTGCAGATGG - Intergenic
1193790807 X:85813405-85813427 CTGTCCCATCAGCAGGAAAATGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194506056 X:94735252-94735274 CTTTATCACCAGCATGAAAACGG - Intergenic
1194524766 X:94966019-94966041 TTTTGCCACCAGCAGGAAAATGG + Intergenic
1195678195 X:107523399-107523421 CTGGGCCACCTGCAGGAAGATGG + Intronic
1196192228 X:112806937-112806959 TTGTGACTCCAGCAGGGAGAGGG + Intronic
1196787105 X:119430527-119430549 CAGTGTCAGCAGCAGGCTGATGG + Intronic
1198393932 X:136204674-136204696 GTGTGTCAGCAGGAGGCAGAAGG + Intronic
1198587767 X:138141674-138141696 CTGTGTCACCACTGGGAAAAAGG + Intergenic
1198919201 X:141707281-141707303 CTTTATCAGCAGCATGAAGATGG - Intergenic
1199325654 X:146494718-146494740 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1199777157 X:151022205-151022227 CTGGGTCTCCAGCAGGCATATGG + Intergenic
1200179092 X:154139590-154139612 CTGTGTCCTCATCAGGAAGATGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200944775 Y:8824068-8824090 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1201773612 Y:17642104-17642126 CTCTGTCACCCGGAGCAAGAGGG + Intergenic
1201827944 Y:18263881-18263903 CTCTGTCACCCGGAGCAAGAGGG - Intergenic