ID: 1128447078

View in Genome Browser
Species Human (GRCh38)
Location 15:67772987-67773009
Sequence AAGGGTCACAAACTTAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128447073_1128447078 23 Left 1128447073 15:67772941-67772963 CCACCTTTTTGAAAGTTAATGCA 0: 1
1: 0
2: 0
3: 18
4: 249
Right 1128447078 15:67772987-67773009 AAGGGTCACAAACTTAATGTAGG 0: 1
1: 0
2: 0
3: 4
4: 125
1128447071_1128447078 27 Left 1128447071 15:67772937-67772959 CCCACCACCTTTTTGAAAGTTAA 0: 1
1: 0
2: 0
3: 28
4: 586
Right 1128447078 15:67772987-67773009 AAGGGTCACAAACTTAATGTAGG 0: 1
1: 0
2: 0
3: 4
4: 125
1128447074_1128447078 20 Left 1128447074 15:67772944-67772966 CCTTTTTGAAAGTTAATGCAGAG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1128447078 15:67772987-67773009 AAGGGTCACAAACTTAATGTAGG 0: 1
1: 0
2: 0
3: 4
4: 125
1128447072_1128447078 26 Left 1128447072 15:67772938-67772960 CCACCACCTTTTTGAAAGTTAAT 0: 1
1: 0
2: 2
3: 30
4: 257
Right 1128447078 15:67772987-67773009 AAGGGTCACAAACTTAATGTAGG 0: 1
1: 0
2: 0
3: 4
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128447078 Original CRISPR AAGGGTCACAAACTTAATGT AGG Intronic
902148884 1:14426298-14426320 AAGGGTCTCAGAGTGAATGTGGG - Intergenic
905089378 1:35416268-35416290 AATGTTCAGAAACTTAATCTTGG + Intronic
907104364 1:51868258-51868280 AAGAGTCACTAACTACATGTGGG + Intronic
908535534 1:65073136-65073158 AAGGGTGAAAAACTATATGTGGG - Intergenic
909321430 1:74291541-74291563 AAGGTTAAATAACTTAATGTAGG + Intronic
914254222 1:145947869-145947891 AAGGGGCAGACTCTTAATGTAGG - Intronic
915146189 1:153796948-153796970 CAGGGTAGCAAAGTTAATGTTGG + Intergenic
916460933 1:165023507-165023529 AAAGGTAACAAACATAAAGTGGG + Intergenic
922252716 1:223864472-223864494 AAAGGTCTCAAACATGATGTGGG + Intergenic
922584666 1:226724546-226724568 AAGGCTCACAGCCTTAAGGTGGG + Intronic
923626523 1:235618180-235618202 TAAGGTCACAAACTTAGTTTGGG + Intronic
1068371744 10:56126081-56126103 AAGTGTCAAGAACTAAATGTTGG - Intergenic
1071984445 10:91036512-91036534 AATGGTCAGAAACTTAAACTGGG + Intergenic
1077134945 11:993831-993853 GAGGTTCACGAACTTGATGTAGG - Exonic
1077981650 11:7307104-7307126 TAAGGTCAAAAACCTAATGTGGG - Intronic
1079141878 11:17816395-17816417 AAGAGTCACAAACCTCATCTTGG - Intronic
1083398843 11:62410195-62410217 AGGGGACAGAAACTTAATCTTGG - Intronic
1085382468 11:76132748-76132770 GAGCAACACAAACTTAATGTAGG + Intronic
1086545221 11:87959872-87959894 AAGAGCCACAAACTTACTCTGGG + Intergenic
1086799491 11:91153666-91153688 AAGGGTCACACTCTGAATGGTGG - Intergenic
1087332680 11:96800885-96800907 AAAGATTACATACTTAATGTAGG - Intergenic
1089814691 11:121161945-121161967 AAAGGTCACAAAGCTAGTGTTGG + Intronic
1093634835 12:21453050-21453072 AAGGGTCAAAACCAAAATGTGGG + Intronic
1094254173 12:28401857-28401879 AAGAATCACAAACTTAACCTAGG - Intronic
1098826409 12:75303210-75303232 AAAACTCACAAACCTAATGTTGG + Intronic
1105595157 13:21830594-21830616 AAGGTTGAAAAACTTACTGTTGG - Intergenic
1106071147 13:26412332-26412354 AAGGGACACATACTTGATGTGGG - Intergenic
1108156143 13:47586641-47586663 AAAGATAACAAACTTAATTTTGG + Intergenic
1108311091 13:49191590-49191612 AAGTGTCACAAACTGTAAGTGGG - Intronic
1108974415 13:56420111-56420133 AAGGGTGACAAAATTTATGCTGG - Intergenic
1109907155 13:68858637-68858659 AAGTGTAACTAACTTAATTTAGG + Intergenic
1110603051 13:77398615-77398637 AAAGGTCACAAACTAATTATCGG + Intergenic
1111246138 13:85544176-85544198 AAGGCTCCCATACTGAATGTTGG + Intergenic
1113838477 13:113345452-113345474 GAGGGTCACATACGTGATGTTGG - Intronic
1114137487 14:19868398-19868420 AAGGGTCACAACAGTAAAGTGGG + Intergenic
1117622467 14:57601436-57601458 AGGGTTGAAAAACTTAATGTTGG - Intronic
1120057759 14:79945561-79945583 GAGGAACACAAACTTAATGTAGG - Intergenic
1120412241 14:84172498-84172520 AAGGTTTACAACCTCAATGTTGG + Intergenic
1123795046 15:23762801-23762823 TGGGGTCAGAAAGTTAATGTGGG - Intergenic
1125440634 15:39699361-39699383 AAAATTCACAATCTTAATGTTGG + Intronic
1127309969 15:57743877-57743899 AAGGGGCCCAAACTTTGTGTTGG - Intronic
1128447078 15:67772987-67773009 AAGGGTCACAAACTTAATGTAGG + Intronic
1130217976 15:81990290-81990312 AAGCTTCACAAGCCTAATGTTGG - Intergenic
1138775016 16:59710700-59710722 AAGTGGCACAAAATTAATATAGG + Intronic
1144281983 17:13735486-13735508 AAGAGTCACTAACTAAAGGTAGG + Intergenic
1144560519 17:16317098-16317120 TAGGGTCAAATACTTTATGTGGG - Intronic
1148972122 17:51492659-51492681 TAAGGTCAGAAACTTAATGTTGG + Intergenic
1149771254 17:59323129-59323151 GAGGGTCACAGACTGAATTTAGG - Intergenic
1151372314 17:73656069-73656091 AAGGGCCACAAACTGTCTGTGGG - Intergenic
1152669434 17:81593527-81593549 ATGGGTAACATAGTTAATGTAGG - Intronic
1155203594 18:23538125-23538147 AAGAATCGCAACCTTAATGTGGG + Intronic
1157117222 18:44873258-44873280 CAGGGTCACAAAGCTAATATTGG - Intronic
1157322714 18:46646777-46646799 AAGGGACAGACACTTAATCTGGG - Intronic
1159500472 18:69262578-69262600 AAAAGGCAGAAACTTAATGTTGG - Intergenic
1164170154 19:22717713-22717735 ATGAGTCACAAACTCAATGGTGG + Intergenic
1164234189 19:23317819-23317841 ATGAGTCACAATCTTAATGGTGG - Intronic
1164248978 19:23460334-23460356 ATGAGTCACAATCTTAATGGTGG - Intergenic
1165069168 19:33245742-33245764 AAGGCACACAAAATTAATTTAGG - Intergenic
1165345581 19:35247321-35247343 AATGGTCACAGAGTTTATGTTGG + Intergenic
925168639 2:1736806-1736828 AAAGGGCACATACTTAAAGTAGG - Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
933319778 2:80758799-80758821 AAGGATCCCAAACTGAATGGGGG - Intergenic
933762931 2:85686021-85686043 AATCGTCACAAGCTTAATTTAGG - Intronic
939268621 2:139909273-139909295 AAGGGTCATAAACATAGAGTGGG + Intergenic
947001052 2:225456704-225456726 AAGAGACACAAACTAAAAGTTGG - Intronic
1168923272 20:1558597-1558619 AAGGGTCACCAGCTGAGTGTGGG - Exonic
1172774957 20:37401891-37401913 AGGGGTCACTGACTTACTGTGGG + Intronic
1174648960 20:52108488-52108510 AAAGGTAATAAACTTAATTTAGG - Intronic
1174891017 20:54393245-54393267 AATGGTGAAAAACTGAATGTTGG - Intergenic
1175209613 20:57344163-57344185 AAAGGTCACATATTTACTGTTGG - Intergenic
1178489287 21:33038116-33038138 AAGGGGAAAAAACTTTATGTAGG + Intergenic
949202477 3:1395450-1395472 AGGGGTCACAAACCTAAGGAGGG - Intronic
951198780 3:19854867-19854889 AAGGGTCTCCAACTTAATCCAGG - Intergenic
954237646 3:49269252-49269274 AAAAGTCACAAACTTATAGTGGG - Exonic
957992088 3:87639145-87639167 AAGGTTGAAAAACTAAATGTTGG - Intergenic
960930240 3:122840254-122840276 AAGGGTAACAAACTCCATATTGG + Intronic
962047508 3:131776262-131776284 AAGGGACACAATCTTACTGAAGG - Intronic
963529123 3:146451409-146451431 CAGGGATAAAAACTTAATGTAGG - Intronic
965315715 3:167187768-167187790 AAGGGGTACAAAATGAATGTTGG + Intergenic
966649927 3:182288900-182288922 AAGGGACACAAAGATATTGTGGG - Intergenic
967044642 3:185725449-185725471 AAAGGTCACAAATTAGATGTGGG + Intronic
970778513 4:19706796-19706818 ATGGGTCACCAACATAATGATGG - Intergenic
971355336 4:25890229-25890251 AAGGATAGCAAAATTAATGTTGG + Intronic
973932363 4:55806034-55806056 TATGGACACAAACTTAATGAAGG + Intergenic
977048500 4:92096674-92096696 AAGGGTAAGAAATTTAATGCTGG + Intergenic
977624774 4:99178622-99178644 AAAAGTCACAACCTTAAGGTGGG - Intergenic
978962982 4:114706863-114706885 AAGAGTCACAAACATAAATTGGG + Intergenic
979055701 4:115991107-115991129 AAGGGTAACAAACAGAATGGTGG - Intergenic
979218915 4:118198452-118198474 CAGGGGCACAAAGTTAATGCAGG - Intronic
983617004 4:169718500-169718522 AAGGGGCACACACATAATCTAGG - Intronic
984563986 4:181305910-181305932 AGGAGTTACAAACTGAATGTAGG - Intergenic
984747336 4:183234484-183234506 AAGGGTCACAGATTTTATTTAGG + Intronic
993474465 5:88347301-88347323 AAGGCTCACAGAGTTAATTTAGG + Intergenic
999581729 5:153046070-153046092 AAGGCTCACAAACTTCAGATGGG - Intergenic
1000894145 5:166834707-166834729 AAGGGTCACAATCTTAAAGGTGG - Intergenic
1005303350 6:24492175-24492197 GAGGGTCTCAAGCTTTATGTGGG + Intronic
1008585964 6:52949501-52949523 AAGGCTCAAAAACATAAAGTTGG + Intergenic
1012615195 6:101268987-101269009 AAGGGTCACAGCCTCACTGTTGG - Intergenic
1015758944 6:136636630-136636652 AATGGACACAAACTAAAAGTAGG + Intronic
1018524488 6:164693352-164693374 AAGAGTCACGAACTTCATGCGGG + Intergenic
1022624627 7:32022324-32022346 AAGGGCCACAGACACAATGTTGG + Intronic
1025171583 7:56762900-56762922 ATGACTCACAAACATAATGTTGG - Intergenic
1025700280 7:63812654-63812676 ATGACTCACAAACATAATGTTGG + Intergenic
1027831226 7:83180425-83180447 AAGGGACACTAACATACTGTTGG - Intergenic
1027957740 7:84903095-84903117 AAGGGTAATAATCTTAATCTGGG - Intergenic
1030619813 7:111776790-111776812 AAATGTTACAAACTTCATGTAGG + Intronic
1031575359 7:123409598-123409620 AAGAGTCGCAACCTTAAAGTTGG - Intergenic
1031943834 7:127817814-127817836 AAGGGTCACAAAAATATTATCGG - Intronic
1033884691 7:145930952-145930974 AAGGGTCAGAAAGGAAATGTGGG - Intergenic
1036174831 8:6527422-6527444 AAGGGTCAGAAACCTCATGAGGG - Intronic
1037382602 8:18303302-18303324 AAGGGTGACAAACTACCTGTTGG - Intergenic
1040861260 8:52001598-52001620 AAGGGTCAGAAGGTCAATGTGGG + Intergenic
1044028306 8:87201941-87201963 AAGGGGAAAAAACTTAATATTGG + Intronic
1045654278 8:104370858-104370880 AAGACTCACAAATTTAATCTTGG + Intronic
1050836520 9:10086975-10086997 AAAGGACTCAAACTTAATTTAGG + Intronic
1050865970 9:10499753-10499775 AATGATAAGAAACTTAATGTGGG - Intronic
1052678076 9:31652210-31652232 AAAGGTCAGAAAATTAATCTAGG + Intergenic
1059702879 9:116792971-116792993 AAGGGTTAAAAACTGAATATTGG + Intronic
1059880162 9:118679326-118679348 AAGGGTAAGAATCTTAATCTAGG + Intergenic
1186202971 X:7172592-7172614 AAGGGAAACATACTGAATGTTGG + Intergenic
1188938409 X:36206207-36206229 AAGGGTCTCAAACTGATTGCTGG - Intergenic
1191628317 X:63292732-63292754 AAGAGTGACAAACTGAATTTAGG + Intergenic
1193092060 X:77504465-77504487 AATGTTCAGGAACTTAATGTGGG + Intergenic
1194258507 X:91665464-91665486 CAGGGTCACAAAGTAACTGTTGG - Intergenic
1197036108 X:121875867-121875889 ATGAGTCAGAAACTTAATTTAGG - Intergenic
1197483901 X:127023435-127023457 AAGGGACACAAACTGGGTGTAGG - Intergenic
1198428768 X:136545599-136545621 CAGGGTCACAAACTTTAGATTGG + Intronic
1200577273 Y:4904963-4904985 CAGGGTCACAAAGTAACTGTTGG - Intergenic
1201769467 Y:17605271-17605293 AAGGGTCAAACAATAAATGTGGG + Intergenic
1201832087 Y:18300714-18300736 AAGGGTCAAACAATAAATGTGGG - Intergenic