ID: 1128448522

View in Genome Browser
Species Human (GRCh38)
Location 15:67786258-67786280
Sequence GAATTGGTAGTCTCTTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128448522 Original CRISPR GAATTGGTAGTCTCTTGGGG TGG Intronic
900297976 1:1961860-1961882 GACTTGGTATTTTCTTGTGGAGG - Intronic
902172693 1:14625842-14625864 GAAGTGGTAGTCATTTGGGCTGG + Intronic
904876788 1:33661380-33661402 GAAATGTTAGTCTCTTGAGATGG + Intronic
907885026 1:58585062-58585084 GAATGGGTTGTCTTGTGGGGAGG - Intergenic
907968044 1:59352578-59352600 CAATTGGTAGATTCTTTGGGGGG + Intronic
909163214 1:72181439-72181461 GAATACGTATACTCTTGGGGTGG + Intronic
914447290 1:147760679-147760701 GAATTGGTTTTCTATTGGGTAGG - Intronic
915109752 1:153555693-153555715 TAAGTGGAAGTCTCTGGGGGAGG + Intergenic
915469185 1:156115469-156115491 GAAGTGGTGGTCTCTGGGAGAGG + Intronic
916314215 1:163429369-163429391 GAATTGGTTATCTCTGGGAGGGG + Intergenic
920272852 1:204779693-204779715 GAATTGGAAGTTTGTTGAGGTGG - Intergenic
920458626 1:206119221-206119243 GAATTTGTAGGCTGTTGAGGAGG - Intergenic
921051737 1:211515948-211515970 GAATTGGTAGTAGGTTGTGGAGG + Intergenic
923163294 1:231336823-231336845 GCCTTGGAAGTCACTTGGGGTGG + Exonic
1064315397 10:14250790-14250812 GAATGGGCAGTCTCAGGGGGAGG + Intronic
1065312289 10:24428059-24428081 GAATTTGTAGTCTCTGGAGCAGG - Intronic
1068229026 10:54146067-54146089 CAAATATTAGTCTCTTGGGGAGG - Intronic
1070512287 10:77172448-77172470 CAATTGGAAATCTCTTGGAGAGG + Intronic
1073874464 10:107906270-107906292 GAATTAGTATTCTGTTGGAGGGG - Intergenic
1075555764 10:123430677-123430699 GGGTTGGCAGTCTCTTGCGGGGG + Intergenic
1075950868 10:126476596-126476618 GAAATGGTCGTCATTTGGGGAGG - Intronic
1078468736 11:11570213-11570235 AAATTGGGAGGCTCTTGGGGTGG - Intronic
1083750839 11:64759737-64759759 AAAGTAGTAGTCTCGTGGGGTGG + Exonic
1084311121 11:68316949-68316971 AAATGGGGAGTCTGTTGGGGAGG + Intronic
1088825863 11:113493744-113493766 GAAATGGTAGCCCGTTGGGGAGG + Intergenic
1090173771 11:124628721-124628743 AAATTGGTAGTCTTCTGGGAGGG + Intronic
1100251096 12:92824699-92824721 GAGTTGGAAGTGTTTTGGGGAGG - Intronic
1100669846 12:96799742-96799764 GAATTTGTAGTCTCTTTTAGGGG + Intronic
1102532650 12:113558195-113558217 GCATTCTTAGACTCTTGGGGAGG + Intergenic
1104723228 12:131058140-131058162 GAACTTCTAGTCTCATGGGGAGG - Intronic
1108684705 13:52808679-52808701 GAATGGGTAGTTCCTTGAGGTGG + Intergenic
1112048888 13:95625313-95625335 GAATTTGTATTTTCTGGGGGTGG - Intronic
1115908969 14:38234400-38234422 GACTTGGTAGTAACTTGGGGAGG + Intergenic
1116278372 14:42867886-42867908 GATTTGGTGATCTGTTGGGGTGG + Intergenic
1124808320 15:32908249-32908271 GAAAGGGGAGTCTCTTGGGGTGG + Intronic
1128448522 15:67786258-67786280 GAATTGGTAGTCTCTTGGGGTGG + Intronic
1131456881 15:92588547-92588569 GTATTGGTATTCTGTTGGGAGGG - Intergenic
1133990509 16:10703215-10703237 GCATTTGTAATATCTTGGGGAGG - Intergenic
1138318052 16:56087283-56087305 GAACTTGTAGTCTACTGGGGAGG - Intergenic
1149177391 17:53889707-53889729 TAATTGCTGGTGTCTTGGGGAGG + Intergenic
1149274774 17:55021223-55021245 GAATTAGCAGATTCTTGGGGTGG + Intronic
1155234755 18:23808049-23808071 GAGTGGGTAGTGTCTTGTGGGGG + Intronic
1157528214 18:48401180-48401202 GATAGGGTAGTCGCTTGGGGAGG + Intronic
1157884554 18:51354008-51354030 GAATTAGCACTTTCTTGGGGTGG - Intergenic
1158644483 18:59232514-59232536 GATTTGGGAGTCTCTGGGGAGGG - Intergenic
1159282180 18:66300189-66300211 GAATAGGGAGGCTCTAGGGGAGG + Intergenic
1165766797 19:38356633-38356655 GAATGGGCAGTGTCTTAGGGAGG + Intronic
1167201637 19:48069401-48069423 GACTTGGCAGCCTCTTGGGCTGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925917286 2:8615721-8615743 GAATTGGAAGCCTCTGGGGTGGG - Intergenic
929764150 2:44830236-44830258 GAATTGGTAAACTCTGGTGGGGG + Intergenic
930553365 2:52864506-52864528 GAATTGGTAGTCTTTTAGAAAGG - Intergenic
933682756 2:85117495-85117517 GAATTTGCAGTCTCTCAGGGAGG - Intergenic
934035460 2:88085345-88085367 GGATTGGGAATCTCTTGGGCTGG - Intronic
939389029 2:141543126-141543148 AAATTGGTTGTCTCTTGGAGAGG + Intronic
942380631 2:175386748-175386770 GATTTGGTAGGGTCCTGGGGTGG + Intergenic
942913103 2:181269923-181269945 GAATTGGCAGCATCTGGGGGTGG - Intergenic
944350508 2:198721222-198721244 GAGTTTGTAGTCTATTGAGGAGG - Intergenic
946080683 2:217115883-217115905 GAAGTGGTATTCTCTAGGGCAGG - Intergenic
1172190530 20:33059609-33059631 GGATTGGGAGTCCCTTGGGGAGG - Intronic
1177523003 21:22254464-22254486 GATTTGGTCTTCTCTTGGGTAGG + Intergenic
1181748357 22:24971711-24971733 AAATTGGTATTTTTTTGGGGGGG + Intronic
953434124 3:42865197-42865219 GTATTGGTTGTGTCTTGGTGAGG + Exonic
953582579 3:44170497-44170519 AGATTGGTAGTTGCTTGGGGAGG - Intergenic
965349006 3:167590297-167590319 GAATTGGTAGTATTTTGTTGAGG + Intronic
965418443 3:168426535-168426557 GACTTTGGGGTCTCTTGGGGTGG + Intergenic
966219445 3:177535979-177536001 GAATTTGTATTCTATTGGGCTGG - Intergenic
968965756 4:3768333-3768355 GGAGTGGTAGTGTCTTTGGGGGG - Exonic
970400499 4:15712778-15712800 CAAATGGTGCTCTCTTGGGGTGG - Intronic
972830511 4:42809469-42809491 TATTTGGTAGTGGCTTGGGGTGG + Intergenic
972948028 4:44282416-44282438 GAATGGGGAGGCTCATGGGGAGG - Intronic
974540744 4:63230949-63230971 GCATTGGTATTGTCTTTGGGGGG + Intergenic
975719357 4:77234949-77234971 ACACTGGCAGTCTCTTGGGGGGG + Intronic
977808368 4:101330445-101330467 GAACTGTCAGTGTCTTGGGGTGG - Intronic
981191053 4:141863719-141863741 GAAGTGGTAGTCAGTTGGCGAGG - Intergenic
998534896 5:142920646-142920668 GCATTGGTACTCTCTAGAGGTGG + Intronic
1000395792 5:160773430-160773452 GAATTGGGACTGTCTTGGCGAGG + Intronic
1000442963 5:161284828-161284850 AAATTGCTAGTCTCTTGTGGCGG - Intergenic
1002104934 5:176875362-176875384 GAATGGGGAGGCTCTGGGGGAGG - Intronic
1009698521 6:67142846-67142868 CAACTGGTAGTATCTAGGGGTGG - Intergenic
1010610243 6:77945981-77946003 GAATTGGTAAGCTCTAGGAGGGG - Intergenic
1011546232 6:88484133-88484155 GAATTTGAAGTTTCTTGGGCTGG - Intergenic
1013220169 6:108071236-108071258 GAATTAGTTGTCTCTTGGGGAGG - Intronic
1014018337 6:116560635-116560657 GAATTTTTAGTATTTTGGGGGGG + Intergenic
1022717614 7:32912930-32912952 AAATTGGTAGACTCTTTTGGAGG + Intergenic
1024122349 7:46257459-46257481 GGATTAATACTCTCTTGGGGTGG - Intergenic
1029982462 7:104891595-104891617 GAATTGGCATTCTCTTGTGTTGG + Intronic
1035103740 7:156423565-156423587 TAATTGGTAGTCTCTTTTGTTGG + Intergenic
1038603508 8:28973618-28973640 GAAGTGGTAGTCTCTGGTGGGGG + Intronic
1040918271 8:52586442-52586464 AAATTGATAGTCTGTTGAGGTGG - Intergenic
1044527243 8:93265754-93265776 GAATTGGTAGTTTCTGGGAAGGG - Intergenic
1045901288 8:107283351-107283373 GAGTTGATAGTCTCATGGTGGGG - Intronic
1058205654 9:102102471-102102493 GTATTGGTATTCTGCTGGGGAGG - Intergenic
1188225065 X:27587409-27587431 GAATTAGTAGGCCCCTGGGGTGG + Intergenic
1194767886 X:97863709-97863731 AAATTGGTACTCTCTTTTGGAGG + Intergenic
1196815502 X:119662467-119662489 GACTTGGTAGGCACTTGGTGTGG - Intronic
1201267312 Y:12220379-12220401 GAAATTCTAGTTTCTTGGGGGGG - Intergenic