ID: 1128452883

View in Genome Browser
Species Human (GRCh38)
Location 15:67817072-67817094
Sequence GCCTAGGGCTGGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128452876_1128452883 20 Left 1128452876 15:67817029-67817051 CCACAGGAAGCAAATCTGTAGAA No data
Right 1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128452883 Original CRISPR GCCTAGGGCTGGAGGGAAGT AGG Intergenic
No off target data available for this crispr