ID: 1128455633

View in Genome Browser
Species Human (GRCh38)
Location 15:67829871-67829893
Sequence CCGCGAGCGCGCGTGGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 1, 2: 7, 3: 13, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128455633_1128455643 27 Left 1128455633 15:67829871-67829893 CCGGCGGCCACGCGCGCTCGCGG 0: 1
1: 1
2: 7
3: 13
4: 99
Right 1128455643 15:67829921-67829943 TCGCTCGTCCCTGGTGGGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 91
1128455633_1128455641 21 Left 1128455633 15:67829871-67829893 CCGGCGGCCACGCGCGCTCGCGG 0: 1
1: 1
2: 7
3: 13
4: 99
Right 1128455641 15:67829915-67829937 TGTAGGTCGCTCGTCCCTGGTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1128455633_1128455642 22 Left 1128455633 15:67829871-67829893 CCGGCGGCCACGCGCGCTCGCGG 0: 1
1: 1
2: 7
3: 13
4: 99
Right 1128455642 15:67829916-67829938 GTAGGTCGCTCGTCCCTGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 31
1128455633_1128455639 4 Left 1128455633 15:67829871-67829893 CCGGCGGCCACGCGCGCTCGCGG 0: 1
1: 1
2: 7
3: 13
4: 99
Right 1128455639 15:67829898-67829920 CCAGTATCTGCGCGCGATGTAGG 0: 1
1: 0
2: 0
3: 1
4: 11
1128455633_1128455640 18 Left 1128455633 15:67829871-67829893 CCGGCGGCCACGCGCGCTCGCGG 0: 1
1: 1
2: 7
3: 13
4: 99
Right 1128455640 15:67829912-67829934 CGATGTAGGTCGCTCGTCCCTGG 0: 1
1: 0
2: 0
3: 0
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128455633 Original CRISPR CCGCGAGCGCGCGTGGCCGC CGG (reversed) Intronic