ID: 1128456508

View in Genome Browser
Species Human (GRCh38)
Location 15:67834484-67834506
Sequence CAACCACCTGGAGCCTGTTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128456502_1128456508 28 Left 1128456502 15:67834433-67834455 CCTCTTGATGTAACAGCACTTTA 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1128456508 15:67834484-67834506 CAACCACCTGGAGCCTGTTTGGG 0: 1
1: 0
2: 1
3: 4
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128456508 Original CRISPR CAACCACCTGGAGCCTGTTT GGG Exonic
901204517 1:7486422-7486444 CAACCTCCTAGGACCTGTTTGGG + Intronic
906312464 1:44763662-44763684 CCACCATGTGGAGCCTGGTTTGG + Intronic
906661337 1:47584590-47584612 TAACTTCTTGGAGCCTGTTTGGG - Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918825302 1:189316292-189316314 CAACCAGCTGCAACCTCTTTAGG + Intergenic
921070258 1:211652533-211652555 GGACCACCTGGATCCTGTCTTGG + Intergenic
923731323 1:236553509-236553531 TGACCACCTGCAGGCTGTTTAGG + Intronic
1065045977 10:21747916-21747938 CAACCTCCTGGAGGCTTTTAGGG + Intergenic
1065490356 10:26276204-26276226 CAAACACCTGGAGCCCTTTCTGG + Intronic
1067452760 10:46392450-46392472 GTCCCTCCTGGAGCCTGTTTGGG + Intergenic
1067584472 10:47467305-47467327 GTCCCTCCTGGAGCCTGTTTGGG - Intronic
1068962364 10:62878779-62878801 CCATCACCTGGAGCCTGTAGAGG + Intronic
1071566621 10:86674503-86674525 CAAACACCTGCAGCCTTTCTTGG + Intronic
1074109214 10:110410687-110410709 CAACCATCTGGATCATGTGTGGG + Intergenic
1074944473 10:118268105-118268127 CAACCAACTGGGGCCTGACTGGG + Intergenic
1076105670 10:127820898-127820920 CAACCACCTGGACCTTTTTGAGG + Intergenic
1079400883 11:20105546-20105568 CAACCACACGGAGCCTGTGAAGG + Exonic
1081008380 11:37776127-37776149 TAACCACCTGGATGCAGTTTTGG + Intergenic
1083920129 11:65778035-65778057 CCGCCACCTGGAGCCTTTTGTGG - Exonic
1084792067 11:71481268-71481290 CAGCCTCCTGGGGCCTGCTTGGG + Intronic
1087191585 11:95259686-95259708 CACCCACCTGGGGCCTTGTTTGG - Intergenic
1090137268 11:124210629-124210651 AAGCCACCTGGAGCCTGTCATGG - Intergenic
1092683916 12:11019059-11019081 CAACCCCTTGGTGGCTGTTTGGG - Intronic
1092688222 12:11074712-11074734 CAACCCCTTGGTGGCTGTTTGGG - Intronic
1096596282 12:52697794-52697816 CAACAACCTGGAGCCCCTCTTGG - Exonic
1101732741 12:107440169-107440191 CATCCACCCTGAGCCTGTGTGGG + Intronic
1102831649 12:116007520-116007542 CAACAACCTGGAGACAGTTTGGG - Exonic
1103018306 12:117513388-117513410 CAAGCAACTGGAGCCAGGTTGGG + Intronic
1103019387 12:117521757-117521779 CAACCAACTGGAACCATTTTTGG - Intronic
1103195866 12:119043378-119043400 CATACACCTGGGGCCTGTTGGGG + Intronic
1105323891 13:19352873-19352895 AAAGCTCCTGGAGCCTGTGTGGG - Intergenic
1105870062 13:24496660-24496682 AAAGCTCCTGGAGCCTGTGTGGG + Intronic
1107072496 13:36286334-36286356 CAACCACCTTCTGCCTCTTTTGG + Intronic
1107795670 13:44049123-44049145 TGATCACCTGGAGCCTGTATGGG - Intergenic
1108817788 13:54313121-54313143 CACCCACCGGGAACCTGTGTTGG - Intergenic
1110103898 13:71645775-71645797 CAACCACCAGGAGCTTTTGTTGG + Intronic
1113491482 13:110695581-110695603 CATCCACCTGCAGCCTGTGCCGG - Intronic
1114493031 14:23114927-23114949 CATCCACCTGGGGACTGTGTAGG + Intergenic
1114704973 14:24715465-24715487 CCACCACCTGAAACCTGTGTGGG + Intergenic
1120035526 14:79692640-79692662 CTTACACCTGGAGGCTGTTTTGG + Intronic
1121265480 14:92599574-92599596 CAACCCCCTGGTGCCTGTGATGG + Intronic
1121875324 14:97445958-97445980 TAAGCACCTGGAGCCTGCTGAGG + Intergenic
1124392141 15:29269219-29269241 CAACACCCTGGAGCCTGTGGAGG - Exonic
1128456508 15:67834484-67834506 CAACCACCTGGAGCCTGTTTGGG + Exonic
1136551136 16:30983216-30983238 CAGCCAACAGGTGCCTGTTTTGG + Intronic
1138512796 16:57518349-57518371 CCACCTCCTGGAGCCATTTTTGG + Intronic
1139503568 16:67387726-67387748 CAACCACAAGGAGGCTGTTAGGG + Intergenic
1141710775 16:85697828-85697850 CTTCCACTTGGATCCTGTTTGGG - Intronic
1148189209 17:45666972-45666994 CAGTCACCTGGAGCCTAATTGGG - Intergenic
1151274685 17:73025186-73025208 CACCCTCCTGGAGCCCGTCTGGG + Intronic
1152904511 17:82962979-82963001 CAGGCACCTGGAGGCTGATTGGG - Intronic
1155274136 18:24169758-24169780 CTAACCACTGGAGCCTGTTTGGG + Intronic
1159026842 18:63190865-63190887 CAACACACTGGAGCCTGTTGAGG - Intronic
1160697012 19:489599-489621 CGGCCCCCGGGAGCCTGTTTCGG - Intronic
1160794822 19:940473-940495 GACCCTTCTGGAGCCTGTTTTGG + Intronic
1161216559 19:3097539-3097561 CAACCAGGTGGAGCATGTTCTGG + Intronic
1162597401 19:11639920-11639942 CAACCAGCTGTACCCTGTCTCGG - Intergenic
1163296704 19:16417386-16417408 CAAGCCCCTTGAGCCAGTTTAGG + Intronic
1168465896 19:56600957-56600979 GAACCACCTGTGGCCTCTTTGGG - Intronic
927103226 2:19803752-19803774 CAAGAACTTGGAGCATGTTTTGG + Intergenic
929558872 2:42943232-42943254 CAACCACCAGGAAACTGCTTGGG + Intergenic
929897690 2:45976125-45976147 AAACCAGCTGTAGCCTGTGTGGG + Intronic
931586222 2:63832404-63832426 CCAACACCTGGAGTCTGTGTTGG - Intergenic
931707316 2:64957947-64957969 CAAACAGCTGGAGGCTGTTATGG - Intergenic
933743131 2:85550631-85550653 CAATCTCCTGGAGCCTTTGTTGG + Exonic
939740069 2:145894853-145894875 CCACCACCTGGAGTCTGGATCGG + Intergenic
939842902 2:147210364-147210386 CAGCCAAGTGGAGGCTGTTTTGG - Intergenic
945433550 2:209793713-209793735 AAACCACCTGGAGTCCCTTTTGG - Exonic
948207821 2:236172031-236172053 GAACCACATGGAGTCTATTTTGG - Intergenic
1171427271 20:25057092-25057114 CAGCGACCTGGGGCCTGCTTTGG - Intronic
1174967086 20:55228485-55228507 CACACACCTGGGGCCTGTTGTGG - Intergenic
1175008002 20:55706199-55706221 CATCCACCTGGAGCATTTGTTGG + Intergenic
1178390954 21:32197840-32197862 AAAACAACTGAAGCCTGTTTGGG - Intergenic
1181058833 22:20272410-20272432 CCACCACCTGGAGGCTGCTGGGG + Intronic
951568216 3:24034400-24034422 CAACCCCCTGCAGCCTGCTGTGG - Intergenic
953468581 3:43146924-43146946 CAACCACCTGGTGCCTCTAATGG - Intergenic
966766380 3:183466484-183466506 TAACTACCTGCAGCCAGTTTAGG + Intergenic
969652852 4:8478021-8478043 CAACCACCTGGAGCCATCCTGGG - Intronic
970378315 4:15480754-15480776 CAACCCCCAGGAGCCTGTGCAGG + Exonic
973292231 4:48482410-48482432 CAACCAGGTGGGGCCTGTTAAGG - Intergenic
975022139 4:69502814-69502836 GAACCAACTGGAGCTTGTTGGGG - Intronic
976447751 4:85150975-85150997 CAAGCACCTGGAGAATATTTTGG - Intergenic
982574375 4:157090155-157090177 CTACAACCTAGAGCATGTTTAGG + Intronic
983787793 4:171756107-171756129 CAACCATCTGGACATTGTTTGGG - Intergenic
986597186 5:9436269-9436291 TGACCACATGGAGCCTGTGTTGG - Intronic
990424484 5:55672332-55672354 CAACAACCTGGAGATTTTTTTGG - Intronic
993878148 5:93332525-93332547 TAAACACCTTGAGCATGTTTTGG - Intergenic
998046427 5:138990714-138990736 AAGCCAGCTGGGGCCTGTTTGGG - Intronic
999643796 5:153698538-153698560 GAGAAACCTGGAGCCTGTTTAGG + Intronic
999687620 5:154117008-154117030 CAACCCACTGCAGCCTCTTTTGG + Intronic
999860908 5:155644756-155644778 CAATCACCTGGTGCCTGTTTAGG + Intergenic
1005642198 6:27807129-27807151 CCACCACCTGGAGCCTGGCCTGG + Intergenic
1007419494 6:41711307-41711329 CCTCTACCTGGAGCCTGTGTGGG - Intronic
1017291235 6:152740644-152740666 AAACAAACTGGAGCCTCTTTTGG - Intergenic
1024198203 7:47080897-47080919 CAACCAGCTGCTGCCTGTCTTGG + Intergenic
1029147267 7:98455381-98455403 CATCCTCCAGGAGCCTGTTGGGG + Intergenic
1029213223 7:98925943-98925965 CTAACACCTGAAGCCTGTGTGGG - Intronic
1030329683 7:108258191-108258213 GGACAACCTGGAGCATGTTTCGG - Intronic
1041469837 8:58196523-58196545 CATCAACCTGGAGGGTGTTTTGG + Intronic
1045814836 8:106267703-106267725 CAACCACCTGCATCCTCTTGGGG - Intergenic
1046969505 8:120205746-120205768 CAACCACATGTAGACTATTTTGG - Intronic
1051502232 9:17790449-17790471 CTACCACCTGGAGACAGTGTAGG + Intronic
1054921739 9:70550156-70550178 CAACCACGAGGATCCAGTTTGGG + Intronic
1060186323 9:121566266-121566288 CAACCACCTGGAACTTATTCGGG + Intergenic
1062292784 9:135804717-135804739 CATCCCCCGGGAGCCTGTTGTGG - Intergenic
1185504396 X:620444-620466 CAAAGACTGGGAGCCTGTTTGGG + Intergenic
1186481653 X:9900904-9900926 TAGCCAGCTGGAGCCTGCTTTGG + Intronic
1189604937 X:42667040-42667062 TAACCAACTGTAGCCTGTTTGGG - Intergenic
1192543666 X:71995526-71995548 AAAGCCCCTGGAGGCTGTTTGGG - Intergenic
1193980466 X:88175955-88175977 CAAGCACCTGGAGACTGTGTAGG - Intergenic
1195368860 X:104153033-104153055 CACCCTCCAGGAGTCTGTTTAGG + Intronic
1195564654 X:106326612-106326634 CAGGCACCTGGAGCATGTTTGGG - Intergenic
1197450996 X:126617710-126617732 CAATCACCAGAAGCATGTTTTGG - Intergenic
1202381022 Y:24276655-24276677 CCACCAACCGGAGGCTGTTTGGG - Intergenic
1202489763 Y:25393471-25393493 CCACCAACCGGAGGCTGTTTGGG + Intergenic