ID: 1128456543

View in Genome Browser
Species Human (GRCh38)
Location 15:67834642-67834664
Sequence GGGAGCCGCCCCGCGGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128456540_1128456543 -4 Left 1128456540 15:67834623-67834645 CCGTGCAACAGGTGGGGGTGGGA 0: 1
1: 0
2: 2
3: 31
4: 236
Right 1128456543 15:67834642-67834664 GGGAGCCGCCCCGCGGGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 85
1128456532_1128456543 20 Left 1128456532 15:67834599-67834621 CCGGCGGAGCGGGGCGGCGGAAC 0: 1
1: 0
2: 0
3: 30
4: 90
Right 1128456543 15:67834642-67834664 GGGAGCCGCCCCGCGGGTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128456543 Original CRISPR GGGAGCCGCCCCGCGGGTTC TGG Intergenic
900447472 1:2688544-2688566 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
900450324 1:2746324-2746346 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
901109955 1:6785926-6785948 GGGGGCCGCGCAGCGGGCTCGGG - Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
904832146 1:33312147-33312169 GGGAGCCCCCCAGGGGGTACAGG + Exonic
923506230 1:234608948-234608970 CGTGGCCGCGCCGCGGGTTCGGG + Exonic
924825137 1:247531070-247531092 GGGAGCCACAGCGAGGGTTCCGG + Exonic
1067808125 10:49407321-49407343 GGGAGGAGCCAAGCGGGTTCAGG - Intergenic
1068538814 10:58268955-58268977 GGGCCCCGCCCCTCGGCTTCAGG + Intergenic
1071794673 10:88991363-88991385 GCGCGCCGCCCCGCGGGGGCGGG + Exonic
1072628164 10:97127756-97127778 GGGAGCCGCCCCAAGGCTGCTGG - Intronic
1075645479 10:124093368-124093390 CGGCGCCCCTCCGCGGGTTCGGG - Intronic
1077085239 11:747002-747024 GGGGGACGCCCTGCGGGTGCAGG - Intergenic
1078190790 11:9091420-9091442 GGGGGCCGTCCCGCCGGGTCGGG - Exonic
1078801061 11:14644273-14644295 GGGAGCAGCGCCGCGGCTGCTGG - Exonic
1083176131 11:60951510-60951532 GGGAGCAGCCCCGCGTGCCCGGG - Exonic
1092187687 12:6493302-6493324 GAGCCCCGCCCCCCGGGTTCCGG + Exonic
1092860734 12:12717285-12717307 GGGAGCCGCCCCGCCGAGGCTGG - Exonic
1097057500 12:56258523-56258545 GGGAGCCGGCGCGCGAGTTCGGG - Intergenic
1106226485 13:27790552-27790574 GGCAGCCGCCCCGCGTGCCCGGG - Intergenic
1118312594 14:64704677-64704699 GGTAGCTGCCCCGCGGGCTCGGG - Exonic
1119539356 14:75428364-75428386 GGGAGCCTCCCCGCGGGGCTGGG - Intronic
1122081349 14:99269971-99269993 AGAAGCCGCCCCGCGGGCTGCGG + Intronic
1122658639 14:103279520-103279542 CGGGGCCGTCCCGCGGGTGCTGG + Intergenic
1122885102 14:104707362-104707384 GGGAGCTGCCCCTCTGGCTCTGG - Exonic
1123056060 14:105571413-105571435 GGGAGCGGCCGAGCGGGTGCTGG + Intergenic
1128456543 15:67834642-67834664 GGGAGCCGCCCCGCGGGTTCTGG + Intergenic
1132589645 16:721070-721092 GGCTGCCCTCCCGCGGGTTCCGG - Exonic
1133801658 16:9090543-9090565 CGGCACCGCCACGCGGGTTCGGG + Intergenic
1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG + Intronic
1142549975 17:732500-732522 CAGAGCCGCGCCGCGGGATCGGG + Exonic
1143519428 17:7437172-7437194 GGGCGCCGCCGCCCGGGTCCCGG - Exonic
1143598511 17:7929566-7929588 GGGAGCCGCCAGGCAGGATCGGG + Intronic
1144828982 17:18121362-18121384 GGGAGCTGCGCCGCGGGCTGTGG - Exonic
1148755967 17:49973096-49973118 GGGCGCCGCTCGGAGGGTTCCGG - Exonic
1152586399 17:81191370-81191392 CGGAGCCGGCCCGCGGGGCCAGG + Intronic
1154070661 18:11149141-11149163 CGGAGCTGCCCGGCGGGCTCCGG + Intergenic
1160544288 18:79642316-79642338 AGGCCCCGCCCCGTGGGTTCTGG - Intergenic
1161203599 19:3029091-3029113 GGGAGCCCCTCCCCGGGTTGGGG + Exonic
1161473553 19:4472881-4472903 AGGAGCCGCGCCCCGGGGTCTGG + Intronic
1161998696 19:7730239-7730261 GGGTTCGGCCCCGCGGGCTCAGG + Intronic
1162371824 19:10284364-10284386 GTGAGCCCCGCCCCGGGTTCAGG - Intronic
1168347782 19:55659304-55659326 GGGAGGCGCTCCGCTGGTCCCGG - Exonic
926095807 2:10080147-10080169 GAGAGCCTCCCCGCGGGGCCCGG - Exonic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
930177411 2:48314860-48314882 GGGAGCTGCGCCGCGGGCTGGGG - Intronic
935196681 2:100820380-100820402 CGGAGCGGCCCCGCGGGGCCGGG - Exonic
935881926 2:107573721-107573743 GGGACCAGCCCCACAGGTTCGGG - Intergenic
937083929 2:119158409-119158431 GGGACCGGCTCCGCGGGTCCTGG + Exonic
938727307 2:134120188-134120210 GGTAGCCGCGCCGCAGGCTCGGG + Exonic
940036814 2:149320401-149320423 CGGAGCCACCCCGCGGGCTCAGG + Intergenic
944801292 2:203239690-203239712 GAGCGCCGCGCTGCGGGTTCGGG + Intronic
1173251618 20:41366726-41366748 GGGTCCCGCCCCGAGGGTCCCGG + Exonic
1179729150 21:43357912-43357934 GGGAGCTGCCCCGAGGGTCCTGG - Intergenic
1183491005 22:38115638-38115660 AGGAGCTGCCCCGCTGCTTCGGG + Exonic
1183517165 22:38273138-38273160 GCCCGCCGCCCCGCGGGTTGGGG + Intergenic
1184766959 22:46577150-46577172 GGAGGCGGCCCCGCGGGTCCCGG - Intronic
950386357 3:12663697-12663719 TGGAGCGGCCCCGCGGCTGCCGG - Intronic
950667761 3:14507517-14507539 GGGAGCCACCCAGCAGGTTTAGG - Intronic
954717429 3:52533619-52533641 GGGTGCGGCCCCCCGGGTCCCGG - Exonic
968434149 4:576317-576339 GGGAGGGGCCCCGCGGGCTGGGG - Intergenic
971279941 4:25234410-25234432 CGGAGCCGCCCCGCGGTTTCAGG + Exonic
973624023 4:52752949-52752971 GGGAGCCGCGCTGCTGGTGCTGG - Intergenic
979318944 4:119300642-119300664 GTGCGCCGCGCCCCGGGTTCCGG + Exonic
985894117 5:2739059-2739081 GGCAGCCCTCCAGCGGGTTCTGG + Intergenic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
998292163 5:140926333-140926355 GGGAGCCGCGCGTCGGGTCCCGG - Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1001906559 5:175478453-175478475 GGGACCCGCCCTCCGGGTCCAGG - Exonic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1003263546 6:4546779-4546801 GGCAGCAGCCCTGAGGGTTCTGG - Intergenic
1004650186 6:17600609-17600631 TGGAGCCGCCGCGCGAGCTCAGG + Exonic
1005669496 6:28091040-28091062 GGGAGCCGCCGCGGGGTTTGAGG - Intergenic
1006665293 6:35688935-35688957 GGGCGCTGCCCCGGGGATTCGGG - Intronic
1011607257 6:89117698-89117720 CGGAGCCTCCCCGCGGGCCCAGG - Intronic
1011622665 6:89257473-89257495 TGGAGCAGCCCCACGGGGTCTGG + Intronic
1017324561 6:153130902-153130924 GGGGGCCGCGCCGCGGGTCCGGG - Intronic
1019088295 6:169502082-169502104 GGCAGCCGCCCCGGGGCTGCGGG + Intronic
1019331318 7:462160-462182 GGGAGCCGGCCTCCGGGTGCGGG - Intergenic
1019371864 7:666271-666293 GGAAGCAGCCCCGCATGTTCCGG - Intronic
1019371880 7:666347-666369 GGAAGCAGCCCCGCGTGCTCCGG - Intronic
1033414451 7:141149781-141149803 GGGTTCCGCCCTGCGGGTTATGG + Intronic
1034545315 7:151785328-151785350 GGGACCAGCCCCGCGGGCACTGG - Intronic
1036708078 8:11059736-11059758 GGGAGCCGCGGGGCGGGGTCCGG - Intronic
1041476818 8:58276756-58276778 GGGAGACTCCCCGAGGGTTCAGG - Intergenic
1041689898 8:60678696-60678718 GCGCGCGGCCCCGCGGCTTCGGG + Intergenic
1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG + Intronic
1042859007 8:73294886-73294908 GGGAGCCGGCGCGCCGGTTCCGG + Exonic
1060114426 9:120929069-120929091 GGGAGCCGCCCTGCGGTCCCGGG + Intronic
1061015944 9:127980836-127980858 GGGACCCGCGCCGCGGGCCCCGG + Intergenic
1061261438 9:129482816-129482838 GGGAGTCACCCCGCGGGGCCCGG + Intergenic
1062234102 9:135499980-135500002 GGGAGTCGCCCGGCAGGTTCCGG - Exonic
1062341270 9:136094902-136094924 GGACGCCGCGCCGCGCGTTCGGG - Intronic
1195259074 X:103115321-103115343 GGGCGCCGCCTCGCTGGATCAGG + Intergenic
1200242732 X:154506429-154506451 GGGAGCAGCCCGGCAGGTTGGGG - Exonic