ID: 1128457460

View in Genome Browser
Species Human (GRCh38)
Location 15:67840267-67840289
Sequence ATGAAGGAATCATGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128457456_1128457460 -2 Left 1128457456 15:67840246-67840268 CCTTGTATCGTATATGCAAATAT No data
Right 1128457460 15:67840267-67840289 ATGAAGGAATCATGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128457460 Original CRISPR ATGAAGGAATCATGGGAAAT AGG Intergenic
No off target data available for this crispr