ID: 1128457688

View in Genome Browser
Species Human (GRCh38)
Location 15:67841479-67841501
Sequence CTCAGTACTGAGAGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128457682_1128457688 -7 Left 1128457682 15:67841463-67841485 CCCAGCAGTGCTGTGGCTCAGTA No data
Right 1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG No data
1128457680_1128457688 16 Left 1128457680 15:67841440-67841462 CCACTGTGGTGGTAGTTGCTGCT No data
Right 1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG No data
1128457678_1128457688 25 Left 1128457678 15:67841431-67841453 CCCGGGAGACCACTGTGGTGGTA No data
Right 1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG No data
1128457683_1128457688 -8 Left 1128457683 15:67841464-67841486 CCAGCAGTGCTGTGGCTCAGTAC No data
Right 1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG No data
1128457676_1128457688 29 Left 1128457676 15:67841427-67841449 CCTTCCCGGGAGACCACTGTGGT No data
Right 1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG No data
1128457679_1128457688 24 Left 1128457679 15:67841432-67841454 CCGGGAGACCACTGTGGTGGTAG No data
Right 1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG No data
1128457674_1128457688 30 Left 1128457674 15:67841426-67841448 CCCTTCCCGGGAGACCACTGTGG No data
Right 1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128457688 Original CRISPR CTCAGTACTGAGAGAGGGGA GGG Intergenic
No off target data available for this crispr