ID: 1128458521

View in Genome Browser
Species Human (GRCh38)
Location 15:67847941-67847963
Sequence CTGTATCCACATGTGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128458515_1128458521 19 Left 1128458515 15:67847899-67847921 CCAGTGAGGGTGGTGTAGCAGCA No data
Right 1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128458521 Original CRISPR CTGTATCCACATGTGGAGGT AGG Intergenic
No off target data available for this crispr