ID: 1128462818

View in Genome Browser
Species Human (GRCh38)
Location 15:67884224-67884246
Sequence CACTTTAAAGATAGGGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128462818_1128462823 14 Left 1128462818 15:67884224-67884246 CCTGCGTCCCTATCTTTAAAGTG No data
Right 1128462823 15:67884261-67884283 ACGTTTTACTACTTGGAAGGAGG No data
1128462818_1128462821 7 Left 1128462818 15:67884224-67884246 CCTGCGTCCCTATCTTTAAAGTG No data
Right 1128462821 15:67884254-67884276 TAATAGCACGTTTTACTACTTGG No data
1128462818_1128462824 18 Left 1128462818 15:67884224-67884246 CCTGCGTCCCTATCTTTAAAGTG No data
Right 1128462824 15:67884265-67884287 TTTACTACTTGGAAGGAGGCTGG No data
1128462818_1128462825 24 Left 1128462818 15:67884224-67884246 CCTGCGTCCCTATCTTTAAAGTG No data
Right 1128462825 15:67884271-67884293 ACTTGGAAGGAGGCTGGACCAGG No data
1128462818_1128462822 11 Left 1128462818 15:67884224-67884246 CCTGCGTCCCTATCTTTAAAGTG No data
Right 1128462822 15:67884258-67884280 AGCACGTTTTACTACTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128462818 Original CRISPR CACTTTAAAGATAGGGACGC AGG (reversed) Intergenic
No off target data available for this crispr