ID: 1128462866

View in Genome Browser
Species Human (GRCh38)
Location 15:67884587-67884609
Sequence TTCCCTCCAGAACCCCACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128462858_1128462866 20 Left 1128462858 15:67884544-67884566 CCTGCAGCTAGTCGGTGGCAGGG No data
Right 1128462866 15:67884587-67884609 TTCCCTCCAGAACCCCACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128462866 Original CRISPR TTCCCTCCAGAACCCCACAG CGG Intergenic
No off target data available for this crispr