ID: 1128463913

View in Genome Browser
Species Human (GRCh38)
Location 15:67892357-67892379
Sequence ATGCTGTTATAGGTAGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128463909_1128463913 -6 Left 1128463909 15:67892340-67892362 CCAAAGACCTCTTATAAATGCTG No data
Right 1128463913 15:67892357-67892379 ATGCTGTTATAGGTAGTGTAGGG No data
1128463906_1128463913 4 Left 1128463906 15:67892330-67892352 CCAAGCCCAGCCAAAGACCTCTT No data
Right 1128463913 15:67892357-67892379 ATGCTGTTATAGGTAGTGTAGGG No data
1128463904_1128463913 26 Left 1128463904 15:67892308-67892330 CCGGGATTAAAGGTGTGAGCCAC 0: 6
1: 1282
2: 3253
3: 4431
4: 4349
Right 1128463913 15:67892357-67892379 ATGCTGTTATAGGTAGTGTAGGG No data
1128463905_1128463913 7 Left 1128463905 15:67892327-67892349 CCACCAAGCCCAGCCAAAGACCT No data
Right 1128463913 15:67892357-67892379 ATGCTGTTATAGGTAGTGTAGGG No data
1128463903_1128463913 30 Left 1128463903 15:67892304-67892326 CCGACCGGGATTAAAGGTGTGAG No data
Right 1128463913 15:67892357-67892379 ATGCTGTTATAGGTAGTGTAGGG No data
1128463908_1128463913 -2 Left 1128463908 15:67892336-67892358 CCAGCCAAAGACCTCTTATAAAT No data
Right 1128463913 15:67892357-67892379 ATGCTGTTATAGGTAGTGTAGGG No data
1128463907_1128463913 -1 Left 1128463907 15:67892335-67892357 CCCAGCCAAAGACCTCTTATAAA No data
Right 1128463913 15:67892357-67892379 ATGCTGTTATAGGTAGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128463913 Original CRISPR ATGCTGTTATAGGTAGTGTA GGG Intergenic
No off target data available for this crispr