ID: 1128467713

View in Genome Browser
Species Human (GRCh38)
Location 15:67926792-67926814
Sequence AATGACATGTGGCATTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128467708_1128467713 9 Left 1128467708 15:67926760-67926782 CCACATTCTCTCCAGTGAAGTGT No data
Right 1128467713 15:67926792-67926814 AATGACATGTGGCATTTAAGGGG No data
1128467707_1128467713 17 Left 1128467707 15:67926752-67926774 CCATATGACCACATTCTCTCCAG No data
Right 1128467713 15:67926792-67926814 AATGACATGTGGCATTTAAGGGG No data
1128467709_1128467713 -2 Left 1128467709 15:67926771-67926793 CCAGTGAAGTGTAAGTGATGTAA No data
Right 1128467713 15:67926792-67926814 AATGACATGTGGCATTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128467713 Original CRISPR AATGACATGTGGCATTTAAG GGG Intergenic
No off target data available for this crispr