ID: 1128468079

View in Genome Browser
Species Human (GRCh38)
Location 15:67929398-67929420
Sequence CTGTGTGATGGTTAGGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128468079_1128468085 23 Left 1128468079 15:67929398-67929420 CCATACACCTAACCATCACACAG No data
Right 1128468085 15:67929444-67929466 CACATGGAGAGGTCTACACAGGG No data
1128468079_1128468082 7 Left 1128468079 15:67929398-67929420 CCATACACCTAACCATCACACAG No data
Right 1128468082 15:67929428-67929450 CGCACACATACACACACACATGG No data
1128468079_1128468084 22 Left 1128468079 15:67929398-67929420 CCATACACCTAACCATCACACAG No data
Right 1128468084 15:67929443-67929465 ACACATGGAGAGGTCTACACAGG No data
1128468079_1128468083 12 Left 1128468079 15:67929398-67929420 CCATACACCTAACCATCACACAG No data
Right 1128468083 15:67929433-67929455 ACATACACACACACATGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128468079 Original CRISPR CTGTGTGATGGTTAGGTGTA TGG (reversed) Intergenic
No off target data available for this crispr