ID: 1128475487

View in Genome Browser
Species Human (GRCh38)
Location 15:67993625-67993647
Sequence TAATCTGAAGGTCAGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128475478_1128475487 29 Left 1128475478 15:67993573-67993595 CCTAAAATGGTGGGATTACAAGC 0: 5
1: 648
2: 22798
3: 271614
4: 285854
Right 1128475487 15:67993625-67993647 TAATCTGAAGGTCAGTCCTGGGG No data
1128475481_1128475487 -2 Left 1128475481 15:67993604-67993626 CCACACCTGGCCAAGAAAGCATA No data
Right 1128475487 15:67993625-67993647 TAATCTGAAGGTCAGTCCTGGGG No data
1128475480_1128475487 1 Left 1128475480 15:67993601-67993623 CCACCACACCTGGCCAAGAAAGC 0: 3
1: 15
2: 189
3: 993
4: 4672
Right 1128475487 15:67993625-67993647 TAATCTGAAGGTCAGTCCTGGGG No data
1128475482_1128475487 -7 Left 1128475482 15:67993609-67993631 CCTGGCCAAGAAAGCATAATCTG No data
Right 1128475487 15:67993625-67993647 TAATCTGAAGGTCAGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128475487 Original CRISPR TAATCTGAAGGTCAGTCCTG GGG Intergenic
No off target data available for this crispr