ID: 1128478622

View in Genome Browser
Species Human (GRCh38)
Location 15:68018515-68018537
Sequence ATTATCAAGCCCATTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128478618_1128478622 -3 Left 1128478618 15:68018495-68018517 CCAGTGAAGCCAGTCAAAGAATT No data
Right 1128478622 15:68018515-68018537 ATTATCAAGCCCATTGAGGAGGG No data
1128478617_1128478622 -2 Left 1128478617 15:68018494-68018516 CCCAGTGAAGCCAGTCAAAGAAT No data
Right 1128478622 15:68018515-68018537 ATTATCAAGCCCATTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128478622 Original CRISPR ATTATCAAGCCCATTGAGGA GGG Intergenic
No off target data available for this crispr