ID: 1128479875

View in Genome Browser
Species Human (GRCh38)
Location 15:68028015-68028037
Sequence TAAAAACCCCAGGCTTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128479875_1128479883 4 Left 1128479875 15:68028015-68028037 CCCAGGTAAGCCTGGGGTTTTTA No data
Right 1128479883 15:68028042-68028064 CACAGGATGCGGGTTAGGGCAGG No data
1128479875_1128479882 0 Left 1128479875 15:68028015-68028037 CCCAGGTAAGCCTGGGGTTTTTA No data
Right 1128479882 15:68028038-68028060 TGCACACAGGATGCGGGTTAGGG No data
1128479875_1128479884 15 Left 1128479875 15:68028015-68028037 CCCAGGTAAGCCTGGGGTTTTTA No data
Right 1128479884 15:68028053-68028075 GGTTAGGGCAGGCGCCATAGTGG No data
1128479875_1128479879 -7 Left 1128479875 15:68028015-68028037 CCCAGGTAAGCCTGGGGTTTTTA No data
Right 1128479879 15:68028031-68028053 GTTTTTATGCACACAGGATGCGG No data
1128479875_1128479886 27 Left 1128479875 15:68028015-68028037 CCCAGGTAAGCCTGGGGTTTTTA No data
Right 1128479886 15:68028065-68028087 CGCCATAGTGGTTTTGGAAAAGG No data
1128479875_1128479881 -1 Left 1128479875 15:68028015-68028037 CCCAGGTAAGCCTGGGGTTTTTA No data
Right 1128479881 15:68028037-68028059 ATGCACACAGGATGCGGGTTAGG No data
1128479875_1128479885 21 Left 1128479875 15:68028015-68028037 CCCAGGTAAGCCTGGGGTTTTTA No data
Right 1128479885 15:68028059-68028081 GGCAGGCGCCATAGTGGTTTTGG No data
1128479875_1128479880 -6 Left 1128479875 15:68028015-68028037 CCCAGGTAAGCCTGGGGTTTTTA No data
Right 1128479880 15:68028032-68028054 TTTTTATGCACACAGGATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128479875 Original CRISPR TAAAAACCCCAGGCTTACCT GGG (reversed) Intergenic
No off target data available for this crispr