ID: 1128479877

View in Genome Browser
Species Human (GRCh38)
Location 15:68028025-68028047
Sequence CCTGTGTGCATAAAAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128479877_1128479882 -10 Left 1128479877 15:68028025-68028047 CCTGGGGTTTTTATGCACACAGG No data
Right 1128479882 15:68028038-68028060 TGCACACAGGATGCGGGTTAGGG No data
1128479877_1128479883 -6 Left 1128479877 15:68028025-68028047 CCTGGGGTTTTTATGCACACAGG No data
Right 1128479883 15:68028042-68028064 CACAGGATGCGGGTTAGGGCAGG No data
1128479877_1128479885 11 Left 1128479877 15:68028025-68028047 CCTGGGGTTTTTATGCACACAGG No data
Right 1128479885 15:68028059-68028081 GGCAGGCGCCATAGTGGTTTTGG No data
1128479877_1128479884 5 Left 1128479877 15:68028025-68028047 CCTGGGGTTTTTATGCACACAGG No data
Right 1128479884 15:68028053-68028075 GGTTAGGGCAGGCGCCATAGTGG No data
1128479877_1128479886 17 Left 1128479877 15:68028025-68028047 CCTGGGGTTTTTATGCACACAGG No data
Right 1128479886 15:68028065-68028087 CGCCATAGTGGTTTTGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128479877 Original CRISPR CCTGTGTGCATAAAAACCCC AGG (reversed) Intergenic
No off target data available for this crispr