ID: 1128479885

View in Genome Browser
Species Human (GRCh38)
Location 15:68028059-68028081
Sequence GGCAGGCGCCATAGTGGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128479876_1128479885 20 Left 1128479876 15:68028016-68028038 CCAGGTAAGCCTGGGGTTTTTAT No data
Right 1128479885 15:68028059-68028081 GGCAGGCGCCATAGTGGTTTTGG No data
1128479877_1128479885 11 Left 1128479877 15:68028025-68028047 CCTGGGGTTTTTATGCACACAGG No data
Right 1128479885 15:68028059-68028081 GGCAGGCGCCATAGTGGTTTTGG No data
1128479875_1128479885 21 Left 1128479875 15:68028015-68028037 CCCAGGTAAGCCTGGGGTTTTTA No data
Right 1128479885 15:68028059-68028081 GGCAGGCGCCATAGTGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128479885 Original CRISPR GGCAGGCGCCATAGTGGTTT TGG Intergenic
No off target data available for this crispr