ID: 1128482767

View in Genome Browser
Species Human (GRCh38)
Location 15:68054386-68054408
Sequence CAGCAGCGGCGCCGTCTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 170}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128482767_1128482782 14 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482782 15:68054423-68054445 TCCGACCCTGGGGGGCCTCTCGG 0: 1
1: 0
2: 0
3: 13
4: 120
1128482767_1128482784 15 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482784 15:68054424-68054446 CCGACCCTGGGGGGCCTCTCGGG 0: 1
1: 0
2: 1
3: 19
4: 177
1128482767_1128482788 30 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482788 15:68054439-68054461 CTCTCGGGCCTGACTCCACCCGG 0: 1
1: 0
2: 0
3: 13
4: 123
1128482767_1128482777 2 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482777 15:68054411-68054433 AGGGGGGATGGGTCCGACCCTGG 0: 1
1: 0
2: 0
3: 10
4: 102
1128482767_1128482778 3 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482778 15:68054412-68054434 GGGGGGATGGGTCCGACCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 108
1128482767_1128482775 -9 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482775 15:68054400-68054422 CCGCTGCTGCCAGGGGGGATGGG 0: 1
1: 0
2: 2
3: 19
4: 233
1128482767_1128482780 5 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482780 15:68054414-68054436 GGGGATGGGTCCGACCCTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 156
1128482767_1128482779 4 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482779 15:68054413-68054435 GGGGGATGGGTCCGACCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 138
1128482767_1128482781 6 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482781 15:68054415-68054437 GGGATGGGTCCGACCCTGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 154
1128482767_1128482773 -10 Left 1128482767 15:68054386-68054408 CCGCGGAGACGGCGCCGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 170
Right 1128482773 15:68054399-68054421 GCCGCTGCTGCCAGGGGGGATGG 0: 1
1: 0
2: 1
3: 50
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128482767 Original CRISPR CAGCAGCGGCGCCGTCTCCG CGG (reversed) Intronic
901641316 1:10694517-10694539 CGGCCGCGGCGCCGCCTCCTCGG + Intronic
902503274 1:16924337-16924359 CAGCAGCGATGCCATCTCTGTGG - Exonic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
904081001 1:27872570-27872592 CTGCAGCGGCACCGGCTCCATGG - Exonic
904652235 1:32014174-32014196 CAGCAGCGGTGGCGGCTGCGTGG - Exonic
904719987 1:32500613-32500635 CAGCTGCAGCGCTGTCTCCGAGG + Intronic
904930352 1:34082351-34082373 CAGCAGCCGCCCCGTCTGGGAGG + Intronic
904930369 1:34082391-34082413 CAGCAGCCGCCCCGTCTGGGAGG + Intronic
907701077 1:56788886-56788908 CAGCAGCGGCATCGTCACCTGGG + Intronic
912955576 1:114152703-114152725 GCGCAGCTGCGGCGTCTCCGGGG - Exonic
914902361 1:151717488-151717510 CGCCCGCGGCGCCGCCTCCGCGG - Intronic
915325324 1:155078919-155078941 CGGCGGCGGCGGCGGCTCCGGGG + Exonic
915969372 1:160343069-160343091 CAGGAGCGGCGCTGACACCGGGG - Intronic
919730692 1:200911978-200912000 CAGCAAGGCCGCCGTGTCCGAGG + Exonic
923093039 1:230753895-230753917 CAGCAGGGGAGGCGTCTCTGGGG - Intronic
924624264 1:245686712-245686734 CAGCACGGCCCCCGTCTCCGAGG + Exonic
1065425432 10:25598232-25598254 CACCAACGGCACCGACTCCGTGG - Exonic
1065738083 10:28772017-28772039 CAGCAGCCGCCCCGTCTGGGAGG + Intergenic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1066140506 10:32500281-32500303 CAGCAGCTGCCCCGTCTGGGAGG - Intronic
1066390933 10:34976757-34976779 CAGCAGCCGCCCCGTCTGGGAGG + Intergenic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1070742894 10:78914055-78914077 CAGCAGCCGGGCCGGCTCGGTGG - Intergenic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1073490398 10:103849486-103849508 CAGCAGGGGCTCAGTCTCTGCGG + Intronic
1076792883 10:132786114-132786136 CGGCGGCGGCGGCGGCTCCGGGG + Intergenic
1076878880 10:133230482-133230504 CAGCAGCAGCTCCGTCTCCCGGG - Exonic
1077492759 11:2869786-2869808 CAGCGGCGGGGCCGGCTCTGCGG + Intergenic
1080863023 11:36166846-36166868 CAGCAGCAGCGGCATCTCCTGGG - Intronic
1081618593 11:44605140-44605162 CTGCATCGGCGCCGTCAACGAGG + Exonic
1083811625 11:65109748-65109770 CAGCCGCCGCGCCGTTTCCCTGG - Exonic
1083998211 11:66282582-66282604 AAGCAGCCGCGCCGTCCCCATGG - Intronic
1084269119 11:68019743-68019765 TAGCAGCTGCCCCGTCTCCTGGG - Exonic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1090325485 11:125882914-125882936 CCGCAGTGGCGCCATCTCCTCGG + Intergenic
1091398210 12:167184-167206 CAGCAGAGGCGGCCTCTCTGGGG - Intronic
1091550283 12:1530969-1530991 CGGCGGCGGGGCCGTCCCCGGGG - Intronic
1091837747 12:3597646-3597668 CAGCAGCGGCCCAGGCTCCTGGG + Intergenic
1102853960 12:116277514-116277536 CCGCGGCGGCGGCGGCTCCGAGG - Intergenic
1103539216 12:121654322-121654344 CAGCAACGGCGACATCTACGAGG - Exonic
1103828733 12:123762220-123762242 CAGCGCCGGCGCCGTCGGCGGGG + Intergenic
1104322158 12:127761981-127762003 AAGAAGCGGCCCCGTCTCCATGG + Intergenic
1104521227 12:129477157-129477179 CAGCAGCAACCCCGTCTCCTTGG + Intronic
1104847934 12:131856086-131856108 CAGCAGTGGCTCTGTCTCCTCGG - Intergenic
1105414051 13:20193547-20193569 CACCAGCGGCGCCCCCTCCTCGG - Intergenic
1112520320 13:100089092-100089114 CAGCAGAGGGGCGGTCTGCGGGG + Exonic
1113392415 13:109910192-109910214 GAGCAGGGGCTCCTTCTCCGAGG - Intergenic
1115664816 14:35534713-35534735 CAGCAGCCGCACCGACCCCGGGG + Exonic
1116018241 14:39432044-39432066 CAGCAGCTGCGACGGCTGCGGGG - Exonic
1117365901 14:55027163-55027185 CAGCTGCGGCGCCCTCCGCGTGG + Intergenic
1117596864 14:57333775-57333797 CAGCAGCCGCCCCGTCTGGGAGG + Intergenic
1121358246 14:93232506-93232528 AAGCAGCGGCGAGCTCTCCGAGG + Intergenic
1122779871 14:104139062-104139084 CAGCAGCGGCGGCGGCTCGCGGG - Exonic
1122972047 14:105156284-105156306 CAGCAGCCGTGCCTTCTCTGTGG - Intronic
1123001926 14:105300473-105300495 GAGCAGCGGCGGCGGCTCCTCGG - Exonic
1126738050 15:51751614-51751636 CAGGGGCGGCGCCGTGGCCGGGG - Exonic
1128482767 15:68054386-68054408 CAGCAGCGGCGCCGTCTCCGCGG - Intronic
1132974120 16:2703045-2703067 CAGCACCGGCGCAGACTCTGCGG + Intronic
1134258513 16:12631068-12631090 CAGCAGCAGCGCTGGCTCTGGGG - Intergenic
1134434899 16:14247416-14247438 CAGCAGCTGAGCAGTCTGCGTGG - Intronic
1135752269 16:25066903-25066925 CTGTAGCGGCTCCGCCTCCGCGG - Intergenic
1138583754 16:57957621-57957643 CAGCAGCGGCACCTGCTCAGAGG + Intronic
1140529038 16:75648247-75648269 CCGCTGCGGCTCCGGCTCCGCGG - Exonic
1142417206 16:89949181-89949203 GAGCAGCGGCGGCGTCCCCGGGG - Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1146716249 17:35089202-35089224 CCGCCGCGGCGGCGTCTCTGGGG + Exonic
1147360646 17:39927520-39927542 CAGCAGCGGCCCCCGCTCCCGGG - Intronic
1148878572 17:50707714-50707736 CAGCGCCGCCGCCGTCGCCGCGG + Exonic
1149599649 17:57885264-57885286 CAGCAGCGGCGGCGTCTATGAGG - Exonic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1152049232 17:77959232-77959254 CGGCGGCGGCGGCGGCTCCGCGG - Intergenic
1152589298 17:81203526-81203548 GAGCGGAGGCGCCCTCTCCGAGG + Exonic
1157455899 18:47828201-47828223 CAGCAGCCGCCCCGTCTGGGAGG + Exonic
1158454384 18:57593518-57593540 CAGCAGCCGCCCCGTCTTCCTGG - Intergenic
1158976888 18:62717056-62717078 CGGCGGAGGCGCCTTCTCCGCGG - Exonic
1161222261 19:3123121-3123143 CAGCAGCGGAGCCCTCTGGGGGG + Exonic
1161304065 19:3557359-3557381 CCGGAGCGGCGCCGTCCCCGCGG - Exonic
1162296673 19:9818708-9818730 CAGGTGCGGCCCCGCCTCCGGGG - Exonic
1162559262 19:11406443-11406465 CAGCCGCTGCGCCCTCTGCGGGG + Exonic
1162572144 19:11480030-11480052 CAGCAGCGGCGGCGGGCCCGCGG + Intronic
1163424847 19:17235659-17235681 CAGTAGCGGCGCCGTGTGCAGGG + Exonic
1163828855 19:19538342-19538364 CAGCAGCGACGCCATGGCCGGGG - Exonic
1164676153 19:30103154-30103176 CAGCAGCTGCCCCGTCTCAATGG + Intergenic
1165091909 19:33392128-33392150 CAGCAGGGGCACCATCTCCAGGG + Intronic
1165481888 19:36069185-36069207 CAGCAGCCGCCCCGTCCCGGAGG - Intronic
1167719225 19:51167394-51167416 CAGCAGCGGCAGCATCTCTGAGG - Intergenic
927181002 2:20446859-20446881 CAGCAGCAGCGCGGACTCCCCGG + Intergenic
927480954 2:23453550-23453572 CAGCAGGGGCTCCGGCTCCAGGG - Intronic
927980328 2:27370785-27370807 CAGCGGCGGCTCCGCCTACGTGG + Exonic
931222279 2:60298342-60298364 AAACAGCGGCACCGTTTCCGAGG + Intergenic
934276214 2:91574522-91574544 CAGCAGCGGGGAGGGCTCCGGGG + Intergenic
934851004 2:97701212-97701234 CATCATCGCCGCCGTCTCAGGGG + Intergenic
938312136 2:130300396-130300418 CAGCCGCGCTGCAGTCTCCGTGG + Intergenic
938895098 2:135741977-135741999 AAGGAGCGGCGCGGTCTTCGTGG + Exonic
943470804 2:188292056-188292078 CGGCCGGGGCGCCGTCTCCGAGG - Intronic
943587730 2:189760391-189760413 CAGCAGCCGCCCCGTCTGGGAGG - Intronic
944582081 2:201139989-201140011 CAGCAGCAGCACCGGCTACGTGG - Intronic
948273053 2:236688473-236688495 CAGCAGTGGCTCCATCTCAGTGG - Intergenic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172873121 20:38147981-38148003 CCGCAGCAGCCCCGTCTACGTGG - Exonic
1175806209 20:61830565-61830587 CTGCAGCGGCCCCGCCTCCCAGG + Intronic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1176194430 20:63830898-63830920 CAGCTGCGGCGCGGGCTCCGGGG - Intronic
1176234845 20:64049426-64049448 CAGCGGCGGCCCCGTGTCCCGGG + Exonic
1180019998 21:45117210-45117232 CAGCAGCGGCTAGGTCTCCCTGG - Intronic
1180102453 21:45595190-45595212 CACCAGTGGTGCCGTCTCCAGGG + Intergenic
1180559045 22:16601351-16601373 CAGCGGCGGCGGCGCGTCCGCGG + Intergenic
1180965139 22:19784309-19784331 CAGCAGCGGCGGCGGGTCCTGGG + Exonic
1181710137 22:24679437-24679459 CAGCTGCGCTGCCGTCTCTGTGG - Intergenic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1183712551 22:39513959-39513981 CCGCAGGCGTGCCGTCTCCGCGG - Exonic
1184230918 22:43158055-43158077 CAGCAGCCGCCCCTTCTCCCTGG + Intronic
1184512508 22:44941883-44941905 CAGAAGCAGCCCCGTCTCCCAGG + Intronic
949982239 3:9509012-9509034 CAGGAGCATCCCCGTCTCCGTGG + Intronic
950421598 3:12902901-12902923 CAGCAGGGGTGCAGGCTCCGTGG - Intronic
952331433 3:32367525-32367547 CAGCAGTGGCGCCCACTCGGTGG - Intronic
953084913 3:39656044-39656066 CAGCAGCCGCCCCGTCTGGGAGG + Intergenic
959951655 3:112185710-112185732 CAGCAAGGCCGCCGTGTCCGAGG - Intronic
960143544 3:114174168-114174190 CAGCAGCGGTGCTATCTCCAGGG - Intronic
960747725 3:120908364-120908386 CAGCGGCGGCGGCGTCCCAGAGG - Intronic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
968622888 4:1611640-1611662 CAGCAGCAGAGGCGCCTCCGTGG + Intergenic
968908787 4:3466322-3466344 CGGCTCCTGCGCCGTCTCCGTGG - Intronic
969398606 4:6938949-6938971 CAGCAGCGGCGCCATCCCCCAGG + Intronic
969425713 4:7122658-7122680 AAGCAGGGGCGCCTTCTCCGGGG + Intergenic
969425733 4:7122727-7122749 AAGCAGGGGCACCTTCTCCGGGG + Intergenic
969425753 4:7122796-7122818 AAGCAGGGGCGCCTTCTCCGGGG + Intergenic
969425773 4:7122865-7122887 AAGCAGGGGCACCTTCTCCGGGG + Intergenic
969425792 4:7122934-7122956 AAGCAGGGGCGCCTTCTCCGGGG + Intergenic
975060258 4:69988458-69988480 CAGCAGTGGCTCTGTCTCAGTGG + Intergenic
977607310 4:98995884-98995906 CCGCAGCGGCGGCATATCCGCGG - Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
982363501 4:154550012-154550034 CAACAGAGGCCCCGCCTCCGAGG + Intronic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985589767 5:758431-758453 CAGCAGCAGCACCGTCTCCCTGG - Intronic
985726612 5:1519624-1519646 CAGCTGCTGTGCCGTCTCCCAGG - Intronic
987003605 5:13686819-13686841 CAGCAGCTGCTCTGGCTCCGGGG + Intergenic
992627636 5:78649075-78649097 CAGCGGCGGCGGCGTCTCCCGGG + Intronic
994041597 5:95265201-95265223 CAGCAGCAGCTCAGTCTCCTTGG + Intronic
997643747 5:135466775-135466797 CAGCAGCGGGGTCGTTTCCAGGG + Intergenic
1003123239 6:3335266-3335288 CAGCAGCGGCGGAGGCTCCGAGG + Intronic
1003843609 6:10148987-10149009 CAGCAGAGGGGCAGTCTCTGGGG - Intronic
1006135967 6:31896957-31896979 CAGCAGCGCCCCCATCTCAGCGG + Exonic
1006799199 6:36748882-36748904 CAGCAGCAGCACCATCTCCTGGG + Intronic
1010300607 6:74255120-74255142 CAGCAGCCGCCCCGTCTGGGAGG - Intergenic
1018668172 6:166158542-166158564 GAGCAACGGCGCCGTCACCCCGG - Exonic
1019316768 7:390554-390576 CGGCAGAGGCGCCTTCTCAGAGG - Intergenic
1020000878 7:4754825-4754847 CAGGGGTGGCGCCGTCACCGAGG + Intronic
1020022956 7:4879932-4879954 CAGCAGCTGTGCTTTCTCCGAGG + Intronic
1020046706 7:5046058-5046080 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1025233938 7:57220956-57220978 CAGCAGCACCGCCGCCTCCCTGG - Intergenic
1026817136 7:73521919-73521941 CAGGAGCGGCGCCATCGCGGCGG + Exonic
1027116569 7:75486080-75486102 CCCCAGCGCCGCCGGCTCCGGGG + Exonic
1027121895 7:75527901-75527923 CCCCAGCGCCGCCGACTCCGGGG + Intergenic
1027275232 7:76549530-76549552 CCCCAGCGCCGCCGGCTCCGGGG - Intergenic
1027960507 7:84940020-84940042 CAGCAGCGGCGCCTCCTCCGGGG + Intergenic
1029720941 7:102364080-102364102 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1031406702 7:121395888-121395910 CAGACGCCGCCCCGTCTCCGCGG + Intronic
1034222997 7:149460171-149460193 CAGTAGCGGCGGCGACTCCGGGG - Intronic
1034618274 7:152436656-152436678 CAGCGGCGGCGGCGCGTCCGCGG - Intergenic
1034995027 7:155571675-155571697 AAGCAGCGGCCCCTTCTCAGAGG + Intergenic
1035286497 7:157810430-157810452 CAGCAGCCCCGCCGTCCCCGTGG - Intronic
1035286507 7:157810465-157810487 CAGCAGCCCCGCTGTCCCCGTGG - Intronic
1035286592 7:157810709-157810731 CAGCAGTCCCGCCGTCCCCGTGG - Intronic
1035286602 7:157810744-157810766 CAGCAGTCCCGCCGTCCCCGTGG - Intronic
1035286619 7:157810814-157810836 CAGCAGTCCCGCCGTCCCCGTGG - Intronic
1036294726 8:7526760-7526782 CAGCTGCAGCGCTGTCTCTGGGG - Intergenic
1036327837 8:7794231-7794253 CAGCTGCAGCGCTGTCTCTGGGG + Intergenic
1036432323 8:8702367-8702389 CTGCAGGGGCGCCGTCGGCGCGG + Exonic
1037260455 8:17001922-17001944 CAGCAGCGGCGGCCGCTCCCCGG + Exonic
1042271909 8:66963098-66963120 CAGCAGGGTCCCCGTCCCCGGGG - Intergenic
1049405436 8:142450073-142450095 CAGCAGCGGCCCCGCCGGCGAGG - Exonic
1049623438 8:143609522-143609544 CAGCTGCGGAGCCGTCTCCGCGG - Exonic
1049643812 8:143727334-143727356 CAGCAGCTGCACCTTCTCAGTGG + Exonic
1049665446 8:143840805-143840827 CCGCCTCGGCGCCGGCTCCGGGG + Exonic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1052754419 9:32526030-32526052 CTCCAGCGGCGCCTTCTCGGCGG - Intronic
1055354589 9:75424833-75424855 CAGCAGCAGCGCCGGCACAGGGG + Intergenic
1060793249 9:126499577-126499599 CAGAAGCGGCCCCGTCTCCTGGG + Intronic
1061112102 9:128580935-128580957 CAGCAGCGCCGCTCTCTCCTCGG - Exonic
1061208599 9:129178057-129178079 CTGCTCCGCCGCCGTCTCCGCGG - Exonic
1061733679 9:132637178-132637200 CAGCAGAGGCTCCATCTCCCTGG + Intronic
1062476012 9:136727948-136727970 CACCAGCGGCGCCTCCTCCGCGG + Intergenic
1062560406 9:137139191-137139213 CGGCGGCGGCGGCGGCTCCGCGG - Intronic
1185460973 X:332686-332708 CCGCAGCGCCGCCGTCCACGAGG + Intergenic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1191828737 X:65392607-65392629 CAGCAGCCGCCCCGTCTGGGAGG + Intronic
1192892748 X:75407609-75407631 CAGCAGCCGCCCCGTCTGGGAGG + Intronic
1198311931 X:135432952-135432974 CAGCAGCAGTGCCATCTCTGTGG - Intergenic
1200097893 X:153672681-153672703 CGGCAGGGGTGCCTTCTCCGAGG - Exonic
1200387416 X:155907793-155907815 CAGCAGCCGCCCCGTCTGGGAGG - Intronic