ID: 1128483003

View in Genome Browser
Species Human (GRCh38)
Location 15:68055189-68055211
Sequence GGTCTCTGCACACACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128482996_1128483003 13 Left 1128482996 15:68055153-68055175 CCTTAGCTGGTGTGGAGGGTGAG 0: 1
1: 0
2: 0
3: 25
4: 337
Right 1128483003 15:68055189-68055211 GGTCTCTGCACACACCATGATGG 0: 1
1: 0
2: 1
3: 10
4: 173
1128482991_1128483003 24 Left 1128482991 15:68055142-68055164 CCCTTCTTTTGCCTTAGCTGGTG 0: 1
1: 0
2: 2
3: 55
4: 1247
Right 1128483003 15:68055189-68055211 GGTCTCTGCACACACCATGATGG 0: 1
1: 0
2: 1
3: 10
4: 173
1128482992_1128483003 23 Left 1128482992 15:68055143-68055165 CCTTCTTTTGCCTTAGCTGGTGT 0: 1
1: 1
2: 0
3: 59
4: 1073
Right 1128483003 15:68055189-68055211 GGTCTCTGCACACACCATGATGG 0: 1
1: 0
2: 1
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128483003 Original CRISPR GGTCTCTGCACACACCATGA TGG Intronic
900802237 1:4744565-4744587 GCTGTGTGCACACAACATGAAGG + Intronic
903358320 1:22761774-22761796 GCAGACTGCACACACCATGAGGG - Intronic
904393413 1:30200326-30200348 GGAGTCTTCACACACCATGTGGG + Intergenic
906665411 1:47617860-47617882 GGGCTCTAGAAACACCATGATGG - Intergenic
907459101 1:54594639-54594661 TGTCTATGCAGACACCATCAAGG + Exonic
910546318 1:88423104-88423126 GGTGTCTGCATACACCACAAAGG + Intergenic
912063234 1:105700679-105700701 TGTCACAGCACACACCATCATGG + Intergenic
912658080 1:111505423-111505445 ATTCTCTGCACATACCATGGGGG + Intronic
915338610 1:155163282-155163304 GGGCTCCTCACAGACCATGAGGG + Intergenic
916914670 1:169393134-169393156 GTTCTCTGCAGACACCAAGTAGG - Intronic
920838408 1:209533573-209533595 GACCCCTGCACACACCATGTGGG + Intergenic
922164443 1:223103227-223103249 GGTCACTGGAAAAACCATGAAGG + Intergenic
1063550809 10:7031029-7031051 GGTCTCTCCTCACCCCATGGTGG - Intergenic
1063854988 10:10239797-10239819 GGCCTCTTCAGAAACCATGAAGG + Intergenic
1065041963 10:21706300-21706322 GGTGCCTGCACATACCATTAGGG + Intronic
1065628802 10:27657171-27657193 GGTCACTGCACAAATCATCACGG + Intergenic
1067567834 10:47351043-47351065 GGCCTTTGCACACACCATGCAGG + Exonic
1070606745 10:77903890-77903912 GGCATCTACATACACCATGAAGG + Intronic
1070691765 10:78532394-78532416 GGTCTCTGCACACTCCACACTGG - Intergenic
1073205379 10:101766577-101766599 GGTCTGAGCACACTCCATCAGGG - Intergenic
1074212882 10:111353807-111353829 GCTCCCTACACACAGCATGATGG - Intergenic
1074441681 10:113482815-113482837 GGTGACTTCACACACCATAATGG + Intergenic
1076483667 10:130801883-130801905 GGTCCCTGCACAGACCGTGCTGG + Intergenic
1076631513 10:131854905-131854927 TCTCTCTGTCCACACCATGAGGG + Intergenic
1076878703 10:133229921-133229943 GGGCTCCGCACACACCTCGACGG + Intergenic
1077141795 11:1028043-1028065 GGTCTCTGCACACACCTCTGGGG + Exonic
1077511753 11:2969018-2969040 GGTCTCGTCACCCACCAGGATGG + Intronic
1077642290 11:3892673-3892695 GGTGACTTCACACACCATAATGG - Intronic
1079231177 11:18650012-18650034 GGTCCCTGCACACACAGTGCCGG - Intergenic
1080358736 11:31487500-31487522 TGTCTATGCATACAACATGAAGG + Intronic
1080600711 11:33818848-33818870 TGTCTCTGCACAGAGCCTGAGGG - Intergenic
1083203637 11:61134489-61134511 GGGCTCTGCACATTCCATCATGG - Intronic
1084174644 11:67416926-67416948 GGTGTCAGCACACTCCATGCCGG + Intronic
1085315044 11:75539728-75539750 GGTCCCTTCACAGACCATGCGGG + Intergenic
1085595133 11:77802419-77802441 TTTCTCTGCACACACCAAGTGGG - Intronic
1087975788 11:104544861-104544883 GGTCTCTGCACATACCTCAATGG + Intergenic
1096994165 12:55828693-55828715 GGCATCAGAACACACCATGATGG - Exonic
1097314579 12:58158502-58158524 AGTCTTTTGACACACCATGAAGG + Intergenic
1099032607 12:77546569-77546591 GGTCTGTGCAAACACCACGTAGG - Intergenic
1099519445 12:83642338-83642360 GGTGCCTGCACACACCATTATGG - Intergenic
1105462749 13:20607354-20607376 GTCCTATGCACACACCATTAAGG + Intronic
1106160311 13:27195482-27195504 GGTCTCTGCACAGAGGAGGAGGG + Intergenic
1114377558 14:22164603-22164625 GGTCTCTGTACCTATCATGATGG - Intergenic
1117487947 14:56217383-56217405 GGTCTCTGCACACCTGATGATGG - Intronic
1117534373 14:56689652-56689674 GGACTCTGCACATACCGTGAAGG - Intronic
1121658478 14:95616297-95616319 ATTCTCTCCAGACACCATGAGGG + Intergenic
1123040413 14:105488000-105488022 GGTCTCAGCACCCTCCATGAGGG - Intronic
1124162259 15:27283185-27283207 GGTCTCTGCCAGCACCATGAAGG + Intronic
1128483003 15:68055189-68055211 GGTCTCTGCACACACCATGATGG + Intronic
1128680711 15:69649335-69649357 TTCCTCTGCACACACCAGGAGGG - Intergenic
1128807600 15:70543173-70543195 CTTTTCTGCACACAGCATGATGG + Intergenic
1129457064 15:75681745-75681767 GGTCTCTGAAGCCACCAGGACGG + Intronic
1129726721 15:77905195-77905217 GGTCTCTGAAGCCACCAGGACGG - Intergenic
1132098700 15:99007365-99007387 CGATTCTGGACACACCATGACGG - Intronic
1132924747 16:2423269-2423291 GGGCGCTGCACACAACACGAAGG - Intergenic
1133267891 16:4595537-4595559 CTTCTCTGCACACCCCTTGAAGG + Intronic
1135054629 16:19220645-19220667 GGTCCCTGTACATATCATGATGG - Intronic
1135858912 16:26037293-26037315 AGTCTCTGCAAGCAACATGAAGG - Intronic
1138575168 16:57903077-57903099 GGGCATTGCACACCCCATGATGG - Intronic
1138638561 16:58364136-58364158 GGCGTATGCACACACCATCAGGG - Intronic
1139847297 16:69930021-69930043 TGTCTCTGCAGAGCCCATGAGGG - Intronic
1140732830 16:77871863-77871885 GGTGTCTCCACCCACCCTGAAGG + Intronic
1141155464 16:81593882-81593904 GCTCTCTGCAAACACCCTTAAGG + Intronic
1141604130 16:85143283-85143305 GGTCTCTGTCCACAGCAGGAGGG + Intergenic
1146263697 17:31437653-31437675 GGTCTCCGTCCACACCCTGAGGG - Intronic
1146790897 17:35750049-35750071 GGGCTCTGCACACGCCCTCAGGG - Intronic
1149268825 17:54955074-54955096 GGTCTCTGCACACAGTCTGAGGG + Intronic
1150216229 17:63471790-63471812 GGTGACTTCACACACCATAATGG + Intergenic
1151334213 17:73430534-73430556 GGTCACTCCGCACACCATGGAGG + Exonic
1152293768 17:79455025-79455047 GGCCTGTGCACACCCCATAAAGG - Intronic
1152461041 17:80442643-80442665 GGTCTCTGCAGTCAGCAAGATGG + Intergenic
1153462784 18:5355029-5355051 GATCCTTGCACACACCAGGAGGG - Intergenic
1153646246 18:7198527-7198549 GCTCTCTGCTCACACGATCAGGG + Intergenic
1155582420 18:27324612-27324634 GGACTCTGCTGACACCATGGGGG - Intergenic
1159552105 18:69905810-69905832 GGTCTCTGCAGATGCCATCAGGG - Intronic
1159898744 18:74022239-74022261 GGTCACAGAACACACCATCAAGG - Intergenic
1160346701 18:78138083-78138105 GGGCCCTGGACACACCATCATGG - Intergenic
1161729315 19:5949411-5949433 GTTCTCTGCAGACAGCCTGAGGG + Intronic
1162489562 19:10984259-10984281 GGGCTCCGCCCACAGCATGATGG + Exonic
1164298221 19:23935157-23935179 GGTCTCTCCCCACAACATGTGGG - Intronic
1164655868 19:29921359-29921381 GGTGACTTCACACACCATAATGG + Intergenic
1166712666 19:44947396-44947418 GTGCTCTGCAGACACCATTAAGG - Intronic
925753874 2:7115025-7115047 GGTCTCAGCACACCCCAGGCAGG - Intergenic
932927538 2:75994289-75994311 AGTGTCTGCTCTCACCATGAGGG - Intergenic
933068645 2:77831743-77831765 GATCTATCCACTCACCATGATGG + Intergenic
935492308 2:103735561-103735583 AGTCTCTGCAGGCACCATCAGGG - Intergenic
936057572 2:109272378-109272400 GGACTGTGCAGGCACCATGAGGG + Intronic
936276916 2:111107046-111107068 GGTCTCCGCTGACACCATGGTGG + Intronic
937609357 2:123841135-123841157 GTTCTCTGCACACAAATTGAAGG - Intergenic
937770658 2:125716901-125716923 GGTCTCTGAACTCATCATGCTGG - Intergenic
939854741 2:147344743-147344765 TGTGTTTGCACACAGCATGATGG + Intergenic
941568542 2:167140556-167140578 GGTCTCTGGATACACGATGGTGG + Intronic
942192706 2:173486148-173486170 GGTGACTTCACACACCATAATGG - Intergenic
942368208 2:175252408-175252430 GGTACCTGCACACAACGTGAAGG + Intergenic
943273561 2:185839530-185839552 GGAATCTGCACACAACTTGAGGG + Intergenic
946489314 2:220132427-220132449 GGTCTTGGCACAGAACATGAGGG - Intergenic
948293014 2:236841493-236841515 GTTCTCAGCACACACCAAGTGGG + Intergenic
948452392 2:238084199-238084221 GGTCTCTACTGACACCATGGTGG - Intronic
1172007390 20:31826782-31826804 GGTCTGTGCACACAGCATCGAGG + Exonic
1172093670 20:32450444-32450466 GGCCTCCCCACCCACCATGAAGG + Intronic
1172108279 20:32529557-32529579 GCTTTCTCGACACACCATGATGG + Intronic
1172915337 20:38439287-38439309 GGTCTGTGCACACATCAGTAGGG + Intergenic
1173787114 20:45802048-45802070 GGTCCCTACTCACACCATGCCGG - Exonic
1174404356 20:50293956-50293978 GGTCTCTGCCCTCACTATGGTGG + Intergenic
1175503273 20:59465256-59465278 GGTCTGTGCTCAAACCATGTGGG + Intergenic
1175552520 20:59826551-59826573 TGTCTCTGCACACACCCTCCTGG + Intronic
1176234784 20:64049223-64049245 GTCCTTTGCCCACACCATGAAGG + Exonic
1177026870 21:15931760-15931782 GGCCTCTGTAGACACCATGCTGG + Intergenic
1181163824 22:20973230-20973252 GGCCTCTGCACCCAGCTTGAGGG + Intronic
1182117832 22:27767475-27767497 GGTTTTTGCACACACCAGTAGGG - Intronic
1183495767 22:38142952-38142974 GGGGTCTGCACCCTCCATGAAGG + Intronic
1184528010 22:45036892-45036914 TGTCTCTGCACCCACCTTGCTGG + Intergenic
1184611605 22:45607473-45607495 GCTCTCTGCAGACACCATCTGGG - Intergenic
1184919570 22:47596283-47596305 GGTCTCCTGACACACCAGGAAGG - Intergenic
951693594 3:25422561-25422583 GGTATCTGCACACATTTTGAAGG + Intronic
955913656 3:63884275-63884297 TCTCTCTCCACACACAATGATGG + Intronic
957576745 3:82017288-82017310 CTTCTCTGGACACACCATGCTGG - Intergenic
960086437 3:113596175-113596197 GGTCTCTGCCCACATCATTGTGG + Intronic
960500962 3:118437679-118437701 GGTCTTTCCTCACACCAGGATGG - Intergenic
960694559 3:120383403-120383425 GGTCTCAATACAAACCATGATGG + Intergenic
960995661 3:123338616-123338638 GTTCTGTGCACCCGCCATGAGGG - Intronic
961433225 3:126897996-126898018 GGCCTCTCCACACACCAGGGTGG - Intronic
962372672 3:134833812-134833834 AATCTCAGCACACACCATGCTGG - Intronic
963556727 3:146799464-146799486 CCTCCCTGCACACACAATGATGG - Intergenic
966302334 3:178493599-178493621 GGTGACTTCAAACACCATGATGG - Intronic
966672450 3:182542765-182542787 GTTTTCTGCACAGACAATGAGGG - Intergenic
968120092 3:196120006-196120028 TGTCTCTGCTCATCCCATGAAGG - Intergenic
968627020 4:1630314-1630336 GGTCTCAGCAGACACCATGGGGG - Intronic
969272874 4:6114634-6114656 TGTTTCTTAACACACCATGAAGG + Intronic
969527928 4:7713476-7713498 GGTCCCTGTACCCACCGTGATGG - Intronic
973627903 4:52791102-52791124 GCTCTTTGCTCACACCATGGGGG + Intergenic
974066390 4:57081522-57081544 GGTCACACCACACACCAAGAAGG - Intronic
977993624 4:103476075-103476097 GGTCCCTGTACTTACCATGATGG - Intergenic
984930774 4:184845228-184845250 GGTCTCAGCACAGGCCAGGATGG + Intergenic
987111616 5:14693017-14693039 GGTCTCCTCACACACTCTGACGG - Exonic
989564921 5:42892596-42892618 GGTGACTGCACACAGCATAATGG - Intergenic
989980099 5:50633322-50633344 GGTGACTTCACACACCATAATGG + Intergenic
991257762 5:64634019-64634041 GGTCCCTGTACCTACCATGATGG - Intergenic
993405973 5:87512269-87512291 GGTTTCGGGAAACACCATGAGGG + Intergenic
996862181 5:128080175-128080197 AGTCCCTGCTCACTCCATGAGGG + Intergenic
997465527 5:134085442-134085464 GGTCTCTTCAGACACAATTATGG + Intergenic
997781917 5:136667681-136667703 GATGTCTACACACACCATCAGGG + Intergenic
998163208 5:139825223-139825245 GGTCTCTGCCCAAACCTTGCAGG - Intronic
1002211361 5:177601244-177601266 GGTCTCTGCTCACATAATTACGG - Intronic
1002346530 5:178551804-178551826 GGGCTCTGGAAACAGCATGAAGG - Intronic
1003986218 6:11437784-11437806 GGTCACTGCACAGTCCATGTGGG - Intergenic
1005349436 6:24919650-24919672 GTTCTCTGCACACAAGACGATGG + Intronic
1006595883 6:35192302-35192324 GGACTCACCACACACCAGGAAGG - Intergenic
1007258472 6:40545299-40545321 GGTCCCTGGACACAGAATGAAGG + Intronic
1007309564 6:40934692-40934714 GCCCCCTGCACACACCGTGAAGG - Intergenic
1007934590 6:45721698-45721720 TTTCCCTGCACACACCAAGAGGG + Intergenic
1008499504 6:52166865-52166887 GTTCTCTGAACACACGATAAAGG + Intergenic
1010274022 6:73948509-73948531 AGTGTCTATACACACCATGAGGG - Intergenic
1016093768 6:140011395-140011417 GGACTCTGAGCACACCATGCAGG + Intergenic
1017814994 6:158010234-158010256 GATGTCTACACACACCAGGAAGG - Intronic
1018364666 6:163107454-163107476 GGTCTCTGCCCACTCGTTGAGGG - Intronic
1019574456 7:1729684-1729706 GGTCTCTGCAGACTCCAGGTGGG + Intronic
1024158068 7:46646852-46646874 TATTTCTGCACCCACCATGAAGG + Intergenic
1025030111 7:55549925-55549947 AGTCTCTGCAGTGACCATGATGG - Intronic
1027962513 7:84964709-84964731 TGTGTCTACACACACCATTAGGG - Intergenic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1032388782 7:131542274-131542296 GGCCTCTGCACCCACCTTGCAGG - Intronic
1032494323 7:132349403-132349425 GCTCCCTGCACACACCAGGCAGG - Intronic
1033248162 7:139736137-139736159 GGGCTTGGCACCCACCATGAAGG + Intronic
1034373967 7:150627259-150627281 CATCTCTCCCCACACCATGATGG - Exonic
1040415277 8:47189397-47189419 GGGCTCTGCACAGGCCAGGAGGG + Intergenic
1043493488 8:80774549-80774571 AGTCTCTGCTCACACCATGAAGG + Intronic
1044712075 8:95067825-95067847 GGTCTCCGCTGACACCATGGGGG + Intronic
1049312906 8:141942877-141942899 GGTCCCAGCATACACCCTGAAGG - Intergenic
1050877023 9:10651477-10651499 TGTACCTGCACACACCATCAGGG + Intergenic
1052758537 9:32566615-32566637 AGCCTCTGCACCCACCATGGAGG + Intronic
1057875384 9:98749623-98749645 GTTCTCTGTACACTCCAAGAAGG + Intronic
1058204395 9:102085130-102085152 GTTCTCTGCACACACTAAGATGG - Intergenic
1060402537 9:123356925-123356947 GGTCTTTGCTCTCAACATGAGGG + Intronic
1060918240 9:127403757-127403779 GGTCTCTGCATAGAACATGACGG - Exonic
1185634916 X:1544752-1544774 GGACCCTTCAAACACCATGATGG - Intergenic
1185650654 X:1645747-1645769 TGTCTCAGCACTCACCATGCAGG - Intergenic
1188453334 X:30332965-30332987 GGTATCTGCAAACTCCTTGAGGG + Intergenic
1189966925 X:46382969-46382991 GGTCTCTATAAATACCATGATGG + Intergenic
1192806520 X:74514555-74514577 GGTCTCTACTGACACCATGGGGG - Intronic
1193236740 X:79115673-79115695 TGTTTCTCCACACAGCATGAAGG + Intergenic
1194625713 X:96224829-96224851 AGTCTCTTAACACACAATGATGG - Intergenic
1195288090 X:103404903-103404925 CGTCTCTCCACACCCCAGGAAGG - Intergenic
1196728304 X:118917052-118917074 GGTCTCTAGCCAGACCATGAAGG + Intergenic
1198708709 X:139477953-139477975 GGTCTCAGCCCAGACCATGCAGG - Intergenic