ID: 1128495831

View in Genome Browser
Species Human (GRCh38)
Location 15:68198020-68198042
Sequence ATGGATCAGCACCCCCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128495824_1128495831 10 Left 1128495824 15:68197987-68198009 CCTTTGACAGCCACCACAGTACA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 1128495831 15:68198020-68198042 ATGGATCAGCACCCCCACCTGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1128495825_1128495831 0 Left 1128495825 15:68197997-68198019 CCACCACAGTACATCTTACCAGG 0: 1
1: 0
2: 1
3: 13
4: 105
Right 1128495831 15:68198020-68198042 ATGGATCAGCACCCCCACCTGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1128495827_1128495831 -3 Left 1128495827 15:68198000-68198022 CCACAGTACATCTTACCAGGATG 0: 1
1: 0
2: 3
3: 11
4: 113
Right 1128495831 15:68198020-68198042 ATGGATCAGCACCCCCACCTGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1128495822_1128495831 26 Left 1128495822 15:68197971-68197993 CCATGTGTGCATTCCACCTTTGA 0: 1
1: 0
2: 1
3: 10
4: 152
Right 1128495831 15:68198020-68198042 ATGGATCAGCACCCCCACCTGGG 0: 1
1: 0
2: 0
3: 16
4: 208
1128495823_1128495831 13 Left 1128495823 15:68197984-68198006 CCACCTTTGACAGCCACCACAGT 0: 1
1: 0
2: 0
3: 20
4: 227
Right 1128495831 15:68198020-68198042 ATGGATCAGCACCCCCACCTGGG 0: 1
1: 0
2: 0
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128495831 Original CRISPR ATGGATCAGCACCCCCACCT GGG Intronic
900464538 1:2818753-2818775 ATGTATCTGCACTCACACCTGGG - Intergenic
900525984 1:3128897-3128919 ACGGCTGCGCACCCCCACCTGGG - Intronic
900903184 1:5530922-5530944 ATGGTTTAGCACCATCACCTTGG + Intergenic
901392351 1:8955061-8955083 ATGGATCAGTGCCGGCACCTGGG - Intronic
901738282 1:11326017-11326039 AAGGATCACCAACCCCAGCTTGG - Intergenic
903242021 1:21989288-21989310 ATCGATCAGCACTGCCAGCTGGG - Exonic
903245529 1:22012476-22012498 ATCGATCAGCACTGCCAGCTGGG - Exonic
904268283 1:29330718-29330740 ATGGGCCTGCACCCCCACCCTGG + Intergenic
907451895 1:54550855-54550877 ATGGGTCACCACACCCAGCTTGG - Intronic
911296139 1:96117548-96117570 AACAATAAGCACCCCCACCTTGG + Intergenic
912101307 1:106209548-106209570 AAGGATCAGTAGCCACACCTGGG + Intergenic
912260835 1:108110578-108110600 ATGGTTCAGCACCATCCCCTTGG - Intergenic
915769358 1:158403589-158403611 AAGGATGAGCACCCCCAGCAGGG + Intergenic
920559342 1:206928065-206928087 ATGGTTCAGCACCAGAACCTAGG + Intergenic
921933923 1:220778492-220778514 ATGGTTTAGCACCACCACCTTGG - Intronic
922607621 1:226900331-226900353 ATGGATCTGCACCTCATCCTTGG - Intronic
923245602 1:232128925-232128947 AGGGATCAGCATCCCACCCTGGG + Intergenic
924024497 1:239818262-239818284 CTGGATTAGGACCCCAACCTTGG + Intronic
924125782 1:240849603-240849625 ATGGCTTAGCACCCTCCCCTTGG + Intronic
924169822 1:241326865-241326887 ATGGAACAGCTCCCCAGCCTGGG + Intronic
924592107 1:245413871-245413893 ATGGATCAGCATCCCAACCGTGG + Intronic
924797106 1:247300442-247300464 ACTGATCAGCGCCCCCACCCAGG - Exonic
1063126383 10:3139989-3140011 CTGTATCAGCCCCCTCACCTGGG + Intronic
1063609778 10:7552663-7552685 GTGGCTCAGGACCTCCACCTGGG + Intergenic
1064034463 10:11903948-11903970 AAGGAACAGAACCCACACCTAGG + Intergenic
1065225050 10:23535006-23535028 ATGGAGCAGAACCTCTACCTAGG - Intergenic
1065242749 10:23724107-23724129 ATGGTTCAGCACCATCCCCTTGG - Intronic
1066692629 10:38045878-38045900 ATGGAGCAGGACTCTCACCTAGG - Intronic
1067000147 10:42603223-42603245 ATGGAGCAGGACTCTCACCTAGG + Intronic
1067098989 10:43321190-43321212 ATGGGTCAGCACCATCCCCTCGG + Intergenic
1067238533 10:44471598-44471620 ATGGAGTAGCACCCAGACCTTGG + Intergenic
1067453648 10:46397914-46397936 ATGGGTCACCGCCCCAACCTGGG + Intergenic
1067583581 10:47461832-47461854 ATGGGTCACCGCCCCAACCTGGG - Intronic
1067633584 10:47987180-47987202 ATGGGTCACCGCCCCAACCTGGG - Intergenic
1069579362 10:69554821-69554843 ATGGAGCAGGAACCCCTCCTGGG - Intergenic
1069838671 10:71325722-71325744 TTGGACCAGCAGCCTCACCTGGG + Intronic
1070784986 10:79157679-79157701 CTGGATCCCCACCCCCAGCTTGG + Intronic
1071860641 10:89669192-89669214 ATGGTTTAGCACCATCACCTTGG - Intergenic
1072889755 10:99312923-99312945 ATGGCTCAGCACCATCTCCTTGG + Intergenic
1073311381 10:102545223-102545245 CTGCCTCAGCACCCCCACCCTGG + Intronic
1074370388 10:112895947-112895969 ATGGATCAGCACCACCTCTATGG - Intergenic
1074405256 10:113175930-113175952 ATGTATCCGCACCTCCTCCTTGG - Intergenic
1075902335 10:126053027-126053049 ATGGTTTAGCACCATCACCTTGG + Intronic
1083683523 11:64362041-64362063 CTGGAACAGCAGCCCCACCTGGG - Intronic
1084768176 11:71325799-71325821 GTGGTTCTGCAGCCCCACCTTGG - Intergenic
1087790082 11:102396218-102396240 AAGGAGCAGCAGCACCACCTGGG - Intergenic
1088369351 11:109072389-109072411 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1090285292 11:125495088-125495110 ATGGATCAGCAACCCCTTCGCGG + Intronic
1094264582 12:28541914-28541936 ATGGATCAGAACCCCAAGATAGG + Intronic
1096120112 12:49083209-49083231 ATGCCACAGCACTCCCACCTGGG + Intergenic
1096518086 12:52169218-52169240 ATGGCTCAGCACCATCTCCTTGG - Exonic
1096720373 12:53516892-53516914 ATGCATCAGAAACCCCACCCTGG + Exonic
1097451524 12:59742347-59742369 ATAATTCAGCAGCCCCACCTAGG - Intronic
1098391090 12:69970836-69970858 ATGGTTCAGCACCATCCCCTTGG + Intergenic
1100807768 12:98305161-98305183 ATGGCTCAGCACCATCCCCTTGG + Intergenic
1102563747 12:113780993-113781015 CTGCATATGCACCCCCACCTTGG + Intergenic
1103705692 12:122870658-122870680 ATGGCTCAGCACGACCTCCTGGG - Intronic
1107950013 13:45453304-45453326 ATGGCTCAGCACCATCCCCTTGG - Intergenic
1108237784 13:48427065-48427087 ATGGTTTAGCACCACCCCCTTGG - Intronic
1108723863 13:53160107-53160129 CTGCCTCTGCACCCCCACCTGGG - Intergenic
1112028422 13:95434364-95434386 ATGGGTCAGCACCCCTATGTAGG + Intronic
1112040471 13:95542175-95542197 ATGGTTCAGCACCATCCCCTTGG - Intronic
1112391935 13:98993004-98993026 ATGAAGCAGCACCCCCAGCATGG + Intronic
1113013167 13:105793890-105793912 ATGGTTTAGCACCATCACCTTGG - Intergenic
1113820410 13:113209171-113209193 AGGGCTCGGCACCCCCACCCCGG - Intronic
1116159778 14:41253695-41253717 ATGGATCTGCAGGCACACCTTGG - Intergenic
1117778642 14:59208785-59208807 ATGGCTCAGCACCATCCCCTTGG + Intronic
1119052480 14:71383769-71383791 ATGGATTAGCACCATCCCCTTGG - Intronic
1119106920 14:71933048-71933070 ATGGACAAGCACCCACACCCAGG - Intronic
1122800091 14:104225097-104225119 ATGGGTCAGCAACGCCCCCTGGG - Intergenic
1123203452 14:106690798-106690820 AGGGCTCAGTTCCCCCACCTTGG - Intergenic
1124243812 15:28053387-28053409 AAGGAAGAGCACCTCCACCTTGG - Intronic
1127498987 15:59538659-59538681 CTGCATCAGCCTCCCCACCTGGG + Intergenic
1128495831 15:68198020-68198042 ATGGATCAGCACCCCCACCTGGG + Intronic
1129457256 15:75682589-75682611 CATGATCAGCACACCCACCTGGG + Exonic
1129726527 15:77904356-77904378 CATGATCAGCACACCCACCTGGG - Intergenic
1131396895 15:92093400-92093422 ATGGCTCAGCACCGCCCCCTTGG - Intronic
1132758330 16:1496655-1496677 CTGGAGCAGCACCACCACCACGG - Intronic
1134211606 16:12282039-12282061 ATGGCTCTGCACTCCAACCTGGG + Intronic
1135286882 16:21201154-21201176 ATGCCGCAGCACCCCAACCTGGG + Intronic
1137652212 16:50130264-50130286 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1137924903 16:52531281-52531303 ATAGATCAGCACCACAAACTAGG - Intronic
1143413070 17:6724003-6724025 ATGGCTCAGCACCATCTCCTTGG - Intergenic
1143993331 17:10985835-10985857 ATGGATCAGCATCCTGACTTTGG + Intergenic
1145956070 17:28855554-28855576 ATGGCTCTGCACCCCGACATGGG + Intronic
1146329388 17:31915339-31915361 GGTGATCTGCACCCCCACCTCGG + Intergenic
1148694975 17:49553352-49553374 ATGAATGAGCACACACACCTCGG + Intergenic
1150573325 17:66407290-66407312 ATGGTTTAGCACCATCACCTTGG + Intronic
1150956788 17:69868471-69868493 ATGGATTATCACCACCCCCTTGG - Intergenic
1153415643 18:4843182-4843204 ATGGGTCAAGAACCCCACCTAGG + Intergenic
1154324928 18:13383089-13383111 GAGGAGCAGCACCTCCACCTGGG + Intronic
1156902899 18:42321953-42321975 ATACCTCAGCACCCCCAGCTTGG + Intergenic
1157891999 18:51426687-51426709 ATGGATTAGCACCATCCCCTTGG + Intergenic
1162711002 19:12594782-12594804 CTGTCTCAGCACTCCCACCTGGG + Intronic
1165845871 19:38817259-38817281 TCGGAGCAGCAGCCCCACCTGGG + Intronic
1166108983 19:40611390-40611412 TGGGCTCAGCACCCTCACCTTGG - Exonic
1167346414 19:48948243-48948265 ATGGTTTAGCACCATCACCTTGG + Intergenic
1167466413 19:49652893-49652915 GCGGATCAGCACCGCCACCTTGG - Exonic
926151941 2:10430136-10430158 GTGGATGAGGACCCCCACATTGG + Intergenic
926239949 2:11077787-11077809 ATGGACTAGGACCCTCACCTTGG - Intergenic
926706868 2:15843358-15843380 ATGGCTCAGCCTCCCTACCTGGG + Intergenic
930650684 2:53961528-53961550 ATGTATCAGCACACCCAGCTAGG - Intronic
930952035 2:57155266-57155288 ATGGTTTAGCACCATCACCTTGG - Intergenic
931824226 2:65982870-65982892 ATGGTTTAGCACCACCACCTTGG + Intergenic
933484967 2:82909595-82909617 ATGGTTTAGCACCATCACCTGGG + Intergenic
937272024 2:120659080-120659102 ATGGTTCAGCAAGCCCTCCTGGG + Intergenic
943797994 2:192022237-192022259 ATGAAGCTGCACACCCACCTGGG - Intronic
944338446 2:198565857-198565879 ATGGTTTAGCACCATCACCTTGG + Intronic
947101403 2:226625245-226625267 ATGGCTCAGCACCATCCCCTTGG - Intergenic
947403299 2:229749951-229749973 ATGGTTCAGCACCAGCCCCTTGG + Intergenic
947516338 2:230808232-230808254 ATGCATCACCACACCCAGCTAGG + Intronic
948134307 2:235624808-235624830 ATGGTTCAGCACCATCCCCTTGG + Intronic
948555737 2:238809622-238809644 AGGGATCTGCCCACCCACCTTGG - Intergenic
1169412238 20:5381613-5381635 ATGGCTTAGCACCATCACCTTGG - Intergenic
1169511590 20:6269634-6269656 ATGGTTTAGCACCATCACCTTGG + Intergenic
1169928491 20:10807641-10807663 ATTAATCAGCATCCCCACCTTGG - Intergenic
1169928644 20:10808588-10808610 ATTAATCAGCATCCCCACCTTGG + Intergenic
1170191971 20:13653166-13653188 ATGGAGCAGAACCCCCTCCTAGG - Intergenic
1171881314 20:30619344-30619366 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1172036418 20:32013934-32013956 CTGGACCAGCAGCACCACCTAGG - Intronic
1174063928 20:47851479-47851501 CAGGGGCAGCACCCCCACCTTGG - Intergenic
1174432751 20:50482534-50482556 AAGGATCAGCAACTCCATCTTGG + Intergenic
1175444945 20:59013491-59013513 ATGCATCAGGACATCCACCTGGG + Intergenic
1179728207 21:43352556-43352578 ATGGATCAGGAGCTCCACCAAGG + Intergenic
1180093810 21:45545288-45545310 ATGGCTTAGCACCATCACCTTGG + Intergenic
1180170186 21:46054591-46054613 AGGGATCAGCACCGCCCACTGGG + Intergenic
1182844958 22:33422824-33422846 ATGGTTTAGCACCATCACCTTGG - Intronic
1183167412 22:36158355-36158377 ATGGCACAGCACCCACTCCTAGG + Intronic
1184285858 22:43471224-43471246 CTGGCTCTGCACCCCCAGCTTGG + Intronic
1184718419 22:46295361-46295383 ATGGTTCAGCACCATCCCCTTGG - Intergenic
950542790 3:13622166-13622188 GTGGATCAGGGACCCCACCTGGG + Intronic
950799815 3:15541286-15541308 ATGGATTAGCACCATCCCCTTGG - Intergenic
953316305 3:41930150-41930172 ATGGAACAGCACACAGACCTCGG + Intronic
953690027 3:45110091-45110113 ATGGCTCAGCACCCCTACTATGG - Intronic
954154987 3:48680460-48680482 CTGGATAAACACCCCCAACTAGG + Intronic
957021769 3:75136359-75136381 CTTGCTCACCACCCCCACCTAGG + Intergenic
957876234 3:86149939-86149961 ATGGTTTAGCACCACCACCTTGG + Intergenic
962405638 3:135097527-135097549 AAGGAAAAGCACCCCCACCCTGG + Intronic
964718952 3:159752699-159752721 ATGGATTAGCACCATCCCCTTGG - Intronic
968127076 3:196167913-196167935 ATGGGTCAGGACCCCGACCTTGG - Intergenic
968753238 4:2401270-2401292 ATGAATCGGCACCTCCCCCTTGG - Intronic
969082412 4:4629062-4629084 ATGGCTTAGCACCATCACCTTGG + Intergenic
972944949 4:44242734-44242756 ATGGTTTAGCACCCTCCCCTTGG + Intronic
973557049 4:52093949-52093971 ATGAATCAAGACCCCCACATAGG - Intronic
973981527 4:56312271-56312293 ATGCATCAGCTTCCCCAGCTGGG + Intronic
978465579 4:109005291-109005313 ATGGTTTAGCACCACAACCTTGG - Intronic
983847979 4:172542703-172542725 ACTGAACAGAACCCCCACCTTGG - Intronic
985060469 4:186072674-186072696 ATGGTTCAGCACCACCCCCTCGG - Intronic
985944900 5:3173023-3173045 ATGGTTCAGCACCATCCCCTGGG + Intergenic
990569548 5:57064414-57064436 ATGGATTAGCACCATCCCCTCGG + Intergenic
993000348 5:82374541-82374563 GGAGATCTGCACCCCCACCTGGG - Intronic
993391865 5:87327922-87327944 ATGGCACTGCACCCCAACCTGGG + Intronic
995799985 5:115983574-115983596 ATGTGTCAGCATCCACACCTTGG + Intronic
995897467 5:117031504-117031526 ATGAATTAGCCCACCCACCTTGG - Intergenic
997124258 5:131209952-131209974 ATGGCTTAGCACCATCACCTTGG + Intergenic
997323776 5:133002760-133002782 ATGCAACAGCACTCCCACCTGGG - Intronic
1003604541 6:7547297-7547319 ATGGCTCACCACCGACACCTTGG + Intronic
1004700717 6:18077040-18077062 ATGGTTCAGCACCATCTCCTTGG - Intergenic
1005331128 6:24751640-24751662 CTGGAGCAGCTTCCCCACCTGGG + Intergenic
1006332975 6:33405378-33405400 AGGGATCAGCCCCTCCAACTGGG - Exonic
1007783023 6:44265026-44265048 AGGGCTCAGCGCCCCCACGTGGG + Exonic
1009931622 6:70182935-70182957 ATGGATTTGCACCCCAACTTTGG - Intronic
1012390531 6:98733072-98733094 ATGGTGCAGCACTCCAACCTGGG + Intergenic
1016700361 6:147047618-147047640 ATGGCTCAGCACCATCCCCTTGG + Intergenic
1017047115 6:150357027-150357049 ATGGCTTAGCACCATCACCTTGG + Intergenic
1017552372 6:155522789-155522811 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1023879286 7:44309272-44309294 AGGGGTCAGCCCACCCACCTGGG + Intronic
1024301555 7:47890934-47890956 GTGCAGCAGCACCACCACCTGGG + Intronic
1024558816 7:50626827-50626849 GTGGAGCACCACCCGCACCTAGG - Exonic
1027751626 7:82154969-82154991 ATGGTTCAGCACCATCTCCTTGG + Intronic
1029521084 7:101062958-101062980 ATGGCTCAGCACCATCCCCTTGG + Intergenic
1029730366 7:102434326-102434348 ATGGATTTGAACCCCCTCCTGGG + Intronic
1032702845 7:134397472-134397494 AGCCATCAGCACCCCCACTTGGG - Intergenic
1032891251 7:136197957-136197979 ATGGATTAGCACCATCCCCTTGG - Intergenic
1033497627 7:141915745-141915767 ATGACTCAGCACAGCCACCTGGG + Intronic
1034206668 7:149322140-149322162 ATGGTTCAGCACCATCCCCTCGG - Intergenic
1035598352 8:879438-879460 AGCGCTCAACACCCCCACCTGGG - Intergenic
1036637034 8:10558278-10558300 ATGGTTAAGCACCATCACCTTGG - Intergenic
1036914547 8:12792841-12792863 ATGGATTAGCACCATCCCCTCGG - Intergenic
1037644635 8:20782117-20782139 AAGGATCAGCACCCAAACTTGGG + Intergenic
1037879688 8:22566593-22566615 ATGGGGTTGCACCCCCACCTAGG - Intronic
1039916249 8:41862434-41862456 ATGAATCAGCAGGTCCACCTGGG - Intronic
1039976715 8:42372691-42372713 ATGGCTCAGCACCATCCCCTTGG - Intergenic
1040577998 8:48671105-48671127 ATGGGCCACCACACCCACCTAGG + Intergenic
1041638735 8:60173908-60173930 ATGGGTCAGCTGCCCCACCCAGG - Intergenic
1042476134 8:69249966-69249988 ATTGCTCAGTAGCCCCACCTTGG + Intergenic
1046060526 8:109134256-109134278 ATGTTTCAGCACCTGCACCTGGG - Intergenic
1046900433 8:119518068-119518090 ATGGAGCAGCACACCCAGATGGG + Intergenic
1047128897 8:121995860-121995882 ATGGTTCAGCACCATCCCCTTGG - Intergenic
1049640423 8:143712707-143712729 ATGCATCAGCTCCCACACCCAGG + Intronic
1049813057 8:144584815-144584837 ATGGATCAGCAAAGCCAGCTGGG - Intronic
1055561974 9:77530221-77530243 ATGGTTTAGCACCCTCACCTTGG + Intronic
1056637571 9:88344370-88344392 ATGGATCAGAACCACCCTCTTGG + Intergenic
1058280070 9:103103295-103103317 ATGTGTCAGCACACCCAGCTGGG - Intergenic
1060398980 9:123336692-123336714 AAGCCTCAGCACCCCCACCCTGG + Intergenic
1060721800 9:125984504-125984526 CTGGAGCATCACACCCACCTGGG - Intergenic
1060785437 9:126448762-126448784 ATGGTTCAGCACCATCCCCTTGG - Intronic
1061235991 9:129342914-129342936 ACGCATCTGCACCTCCACCTGGG + Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1191769073 X:64735613-64735635 ATGGGTTAGCACCACCCCCTTGG - Intergenic
1191958840 X:66677066-66677088 ACTCATCAGAACCCCCACCTAGG - Intergenic
1192038884 X:67596007-67596029 ATGGCTCAGCACCATCCCCTTGG + Intronic
1193466285 X:81852053-81852075 ATGGTTTAGCACCACCCCCTTGG - Intergenic
1193802025 X:85947342-85947364 ATGGTTTAGCACCATCACCTTGG + Intronic
1195717180 X:107828025-107828047 ATGGTTTAGCACCATCACCTTGG + Intronic
1198121604 X:133598193-133598215 ATGCCACTGCACCCCCACCTGGG - Intronic
1198207719 X:134483727-134483749 ATGGATCAATTACCCCACCTGGG - Intronic
1198842449 X:140872604-140872626 ATGGTTCAGCACCACCCCCTTGG - Intergenic
1199188693 X:144945436-144945458 ATGGTTTAGCACCATCACCTCGG - Intergenic
1200247238 X:154532732-154532754 ATGGAACTGCAGCCTCACCTCGG + Exonic