ID: 1128496126

View in Genome Browser
Species Human (GRCh38)
Location 15:68199639-68199661
Sequence CTGTATGACAAGCAGCAGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 279}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128496126_1128496134 16 Left 1128496126 15:68199639-68199661 CCCCTCTGCTGCTTGTCATACAG 0: 1
1: 0
2: 2
3: 29
4: 279
Right 1128496134 15:68199678-68199700 TACTCTGCACACGGCCCAGAGGG 0: 1
1: 0
2: 0
3: 10
4: 161
1128496126_1128496135 19 Left 1128496126 15:68199639-68199661 CCCCTCTGCTGCTTGTCATACAG 0: 1
1: 0
2: 2
3: 29
4: 279
Right 1128496135 15:68199681-68199703 TCTGCACACGGCCCAGAGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 179
1128496126_1128496136 20 Left 1128496126 15:68199639-68199661 CCCCTCTGCTGCTTGTCATACAG 0: 1
1: 0
2: 2
3: 29
4: 279
Right 1128496136 15:68199682-68199704 CTGCACACGGCCCAGAGGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 195
1128496126_1128496133 15 Left 1128496126 15:68199639-68199661 CCCCTCTGCTGCTTGTCATACAG 0: 1
1: 0
2: 2
3: 29
4: 279
Right 1128496133 15:68199677-68199699 GTACTCTGCACACGGCCCAGAGG 0: 1
1: 0
2: 1
3: 5
4: 94
1128496126_1128496131 7 Left 1128496126 15:68199639-68199661 CCCCTCTGCTGCTTGTCATACAG 0: 1
1: 0
2: 2
3: 29
4: 279
Right 1128496131 15:68199669-68199691 CATTCCTTGTACTCTGCACACGG 0: 1
1: 0
2: 2
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128496126 Original CRISPR CTGTATGACAAGCAGCAGAG GGG (reversed) Exonic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
901168661 1:7237891-7237913 CTATATGACAGGCAGCACACCGG + Intronic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
904577391 1:31513900-31513922 TGGGATGACTAGCAGCAGAGAGG - Intergenic
904864326 1:33565131-33565153 CTGTATGAGAAAGAGAAGAGAGG + Intronic
906135813 1:43500092-43500114 CTGCATCACAGGCAGCAGGGAGG - Intergenic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907643214 1:56213680-56213702 CTCTATGAGATGCAGCAGTGTGG - Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
909053051 1:70790639-70790661 CTGTGGGACAACCTGCAGAGTGG + Intergenic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
910559788 1:88577997-88578019 CATTATGACAGGAAGCAGAGTGG + Intergenic
911003338 1:93190921-93190943 CGATATGACAGGAAGCAGAGTGG - Intronic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
912372634 1:109185731-109185753 CTGTATGAGAGGCTGGAGAGAGG + Intronic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
912953803 1:114138491-114138513 CTATACGGCAGGCAGCAGAGTGG + Intronic
915185065 1:154098530-154098552 TGGGATGACCAGCAGCAGAGAGG - Intronic
916476940 1:165178540-165178562 CTGTATTACAGGCAGCATTGGGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
922457106 1:225783874-225783896 CTGTATCAAAAGCAGCAAGGAGG - Intronic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923334742 1:232958412-232958434 CTGAATGTCAAGGAGCAGAGAGG - Intronic
924791716 1:247256653-247256675 CTGTATGACAAACAGAAGACTGG - Intergenic
1063111898 10:3045355-3045377 TTGTAAGACAAACAGCAGCGTGG - Intergenic
1064185641 10:13159650-13159672 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1065787346 10:29229205-29229227 CTGTATGTCAAGCAGAGTAGAGG - Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG + Intergenic
1071824435 10:89310691-89310713 CTGTATGTAAAGCAGCTGAAGGG - Intronic
1073329094 10:102659342-102659364 CTCTGTGACAAGCAGCAGGGAGG - Intergenic
1074696132 10:116051550-116051572 CTGTCTGACCAGTGGCAGAGGGG - Intergenic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1077290967 11:1792670-1792692 CGTTATGACAGGAAGCAGAGTGG + Intergenic
1078042758 11:7883963-7883985 CTGGATGATCAGCCGCAGAGAGG - Intergenic
1079029395 11:16974874-16974896 CGTTATGACAGGAAGCAGAGTGG - Intronic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083904055 11:65658717-65658739 CTGTGTGACAAGGTGCAGAAAGG - Exonic
1084001389 11:66296953-66296975 CGGCATGCCCAGCAGCAGAGTGG - Intergenic
1084268713 11:68017962-68017984 CTGTTTAGCAAGAAGCAGAGTGG - Intronic
1085206765 11:74738657-74738679 CATTATAACAAGAAGCAGAGTGG - Intergenic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086256661 11:84885065-84885087 CTGTATGATAAGAAGAAGTGAGG - Intronic
1088332205 11:108665503-108665525 CAGTGTGGCAAGCAGAAGAGTGG - Intronic
1089082527 11:115788730-115788752 CTGTATGGCAAGGAACTGAGGGG + Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090726201 11:129529514-129529536 GTGTATGAAAGGCAGCATAGAGG - Intergenic
1092104418 12:5911268-5911290 CTACATGAAAAGCAGGAGAGAGG + Intronic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092953238 12:13526867-13526889 CTGTAGAAAATGCAGCAGAGGGG + Intergenic
1095135470 12:38596006-38596028 CTGTATTTCAATCAGCAGAAAGG + Intergenic
1096402208 12:51316650-51316672 ATCTATGACAAGCAACAGTGTGG - Intronic
1097579697 12:61439823-61439845 TTCTAGGACAAACAGCAGAGTGG + Intergenic
1097794750 12:63849546-63849568 TTGTATGTCAGGCTGCAGAGTGG - Intronic
1098894111 12:76038056-76038078 CTGGATGAAATGGAGCAGAGAGG + Exonic
1103920107 12:124394975-124394997 CTGGAGGATGAGCAGCAGAGGGG - Intronic
1104267703 12:127251929-127251951 CTGAAGGACAATAAGCAGAGAGG - Intergenic
1104485734 12:129149975-129149997 ATGTATGCCCAGCAACAGAGGGG + Intronic
1104534611 12:129607371-129607393 CTGCATGCCAAGCTCCAGAGGGG - Intronic
1104709401 12:130974859-130974881 CAGGCAGACAAGCAGCAGAGAGG - Intronic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1114883757 14:26821371-26821393 CTGTATGGCAAGGAGCACAATGG + Intergenic
1116075739 14:40108487-40108509 CTGCAGGATAAGCAGCAGAGAGG - Intergenic
1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG + Intronic
1121732663 14:96197408-96197430 CTACAAGGCAAGCAGCAGAGCGG - Intergenic
1125016574 15:34943197-34943219 CGTTATGACAGGAAGCAGAGTGG + Intronic
1125099718 15:35897951-35897973 ATGTCTGAGAAGCAACAGAGTGG - Intergenic
1126364383 15:47878697-47878719 CTGTATGAAAAGCAGCTGAAAGG + Intergenic
1126800517 15:52293573-52293595 CTGTATGAGAGACAGCAGGGTGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1131100733 15:89688112-89688134 CATTATGACAGGAAGCAGAGTGG - Intronic
1131445823 15:92497274-92497296 CTGTAAGAGAACCACCAGAGTGG - Intronic
1132179017 15:99737623-99737645 CTTTATTCCAGGCAGCAGAGAGG - Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1136067162 16:27766998-27767020 CTGAGTGAGAAGCAGCAGGGGGG + Intronic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137468031 16:48729037-48729059 ATGTTTGAGAAGCAGCAGGGAGG - Intergenic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138189563 16:55003439-55003461 TTGTATGACAAACACCTGAGGGG + Intergenic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1140044993 16:71434528-71434550 CTCTATGGCAAGCACCAGGGTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141209735 16:81966302-81966324 CTGTACAACAAGCCACAGAGCGG + Intergenic
1141550090 16:84801058-84801080 CTGTAGAACAGACAGCAGAGTGG + Intergenic
1142171555 16:88625179-88625201 CTGTAATACAAGCAACAGCGGGG - Intronic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1142682872 17:1560813-1560835 CTGGATGTCAAGAAACAGAGGGG + Intronic
1145070413 17:19800817-19800839 CTGTATGAGAGGCAGCACTGAGG - Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1146611356 17:34307887-34307909 CTGTAGGACAGGCAGGATAGTGG - Intergenic
1146945621 17:36871099-36871121 CTGTATTACAAGCATCAGCTTGG + Intergenic
1149085491 17:52710421-52710443 CTGGAGGACATGCTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1151512970 17:74572908-74572930 CTGGGTGACAAGAAGCAGTGAGG + Intergenic
1151634806 17:75338944-75338966 CGTTATGACAGGAAGCAGAGTGG + Intronic
1153084314 18:1266194-1266216 TTGTATCACAAGCAACAAAGAGG + Intergenic
1153522897 18:5968803-5968825 TTGTATGAGAAGCTGCACAGAGG - Intronic
1153728592 18:7983063-7983085 GTGTTTGACAAGCAGAAAAGAGG - Intronic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157392220 18:47312395-47312417 CAGAATGACAAGCAGCAGCCTGG + Intergenic
1159123896 18:64200952-64200974 CTGAATGACAGGCAGGGGAGAGG - Intergenic
1159795646 18:72840012-72840034 CTATAAGACAAGCTACAGAGAGG - Intronic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160672922 19:374774-374796 CTGTATGCCAGGCCCCAGAGGGG + Intronic
1161261175 19:3338679-3338701 CTGTACGACAAGCCCCAGGGTGG + Intergenic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162018628 19:7858630-7858652 CTGTGTCACAGGCAGCAGACAGG + Intronic
1162117775 19:8441988-8442010 CTGTAGGAAGAGCAGCAGGGAGG + Intronic
1166254223 19:41590868-41590890 CTGTAAGACAAGCACAGGAGAGG + Intronic
1167886024 19:52500730-52500752 ATGTATGTCAGGGAGCAGAGGGG + Intronic
1167888052 19:52518111-52518133 ATGTATGTCAGGGAGCAGAGCGG + Intergenic
1167916407 19:52743502-52743524 ATGTATGTCAGGGAGCAGAGTGG - Intergenic
1168665553 19:58202284-58202306 CTGGAAGGGAAGCAGCAGAGAGG + Intronic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
926268687 2:11348132-11348154 CTGAATGACAAGCAACAGACTGG - Intronic
927100906 2:19787130-19787152 CCGAATCACAAGCAGGAGAGAGG + Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
928845087 2:35661832-35661854 CTGTATGAAATGGAGCAAAGTGG - Intergenic
928893969 2:36239937-36239959 CTGTTTGCCAAGTAACAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
929746419 2:44664130-44664152 GTTTATTAAAAGCAGCAGAGTGG + Intronic
932113713 2:69025333-69025355 TTGCATGACAAGCAGTGGAGTGG + Intronic
932175240 2:69594922-69594944 CGTTATGACAGGAAGCAGAGTGG - Intronic
934619823 2:95797268-95797290 CTGTATGGCTCGGAGCAGAGAGG - Intergenic
934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG + Intronic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
934945610 2:98539097-98539119 CACAATGATAAGCAGCAGAGAGG - Intronic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
937878812 2:126849893-126849915 CTGTATGAAAGGCACCAGGGAGG - Intergenic
939465335 2:142547352-142547374 CTCTGTGCCAAGCAGGAGAGAGG - Intergenic
940416820 2:153432623-153432645 GTGGATGACAAGCAGCACTGGGG - Intergenic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
943961236 2:194265342-194265364 TGGGATGACAAGCTGCAGAGAGG + Intergenic
944335463 2:198528533-198528555 CTGAATGACCTGCAGCAGACTGG + Intronic
944961540 2:204880359-204880381 CAGTTTGAAATGCAGCAGAGTGG + Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946522868 2:220485730-220485752 CTGCAGGACAGGCAGCAAAGAGG + Intergenic
946714410 2:222538467-222538489 CTGTATAAAATGCAACAGAGAGG - Intronic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
1169536006 20:6541187-6541209 CTGTATTCCAGGCAGCAGAAAGG - Intergenic
1170142030 20:13133938-13133960 CTGTATGACAAGCATCCCACTGG + Intronic
1170188962 20:13625607-13625629 CTTTCTGACAGTCAGCAGAGAGG - Intronic
1172639044 20:36430071-36430093 CTGTCTGCCATGGAGCAGAGAGG - Intronic
1172764484 20:37344162-37344184 CAGTATGCCAACCTGCAGAGTGG - Intergenic
1173664216 20:44753557-44753579 CTGTTTGAAGAGGAGCAGAGAGG - Intronic
1174263238 20:49312768-49312790 CTGAATGACAAGCAGCATCATGG + Intergenic
1174546302 20:51327849-51327871 CTGTCTGGAAAGGAGCAGAGAGG - Intergenic
1174849963 20:53984396-53984418 CTGTATGACAGGAAGCAAACAGG + Intronic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1175860425 20:62147504-62147526 CTGCATGCCAAGCAGCAAAGAGG - Intronic
1176411266 21:6450737-6450759 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1176411279 21:6450786-6450808 CAGTGTGACAGGCAGGAGAGCGG - Intergenic
1179686759 21:43059059-43059081 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1179686772 21:43059108-43059130 CAGTGTGACAGGCAGGAGAGCGG - Intronic
1181677609 22:24466853-24466875 TGTTGTGACAAGCAGCAGAGAGG + Intergenic
1182450990 22:30421281-30421303 CATTAGGACAAGCACCAGAGTGG + Intronic
1182486375 22:30641438-30641460 CTGTCTGGCAGGCAGCAGACAGG - Intronic
1182746126 22:32606765-32606787 CTGAATGAAGAGGAGCAGAGAGG - Intronic
1183334335 22:37237989-37238011 CTGAATGACAGGAAGCAGGGAGG + Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
950102711 3:10367800-10367822 TTGTATGACAACCCACAGAGTGG - Intronic
950847463 3:16028825-16028847 CTGAGTGAGAAGTAGCAGAGAGG - Intergenic
951448474 3:22809997-22810019 GTGTAGGACAAGTAGCTGAGAGG - Intergenic
951614443 3:24525536-24525558 CTGTATGACAAGGAAGAGAAGGG + Intergenic
952610118 3:35198676-35198698 CTCTATGACAAGAAGCTGGGTGG + Intergenic
953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG + Exonic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954301094 3:49701227-49701249 CTGTGGGACAAGCTGGAGAGAGG - Intronic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956713882 3:72061606-72061628 CTGTAAGACAAGGATTAGAGTGG + Intergenic
959863660 3:111242810-111242832 TAGGATGACCAGCAGCAGAGAGG - Intronic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
962824500 3:139088269-139088291 TGGGATGACCAGCAGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963161540 3:142155777-142155799 CTCTGGGACAAGCATCAGAGAGG + Intergenic
963318510 3:143786593-143786615 CTGTATTTCTGGCAGCAGAGAGG - Intronic
963702225 3:148640807-148640829 CTGTAAGACAAACAGAGGAGAGG - Intergenic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
964255018 3:154766335-154766357 TGGGATGACCAGCAGCAGAGGGG - Intergenic
964535502 3:157716791-157716813 CTGTATGAAAACCAGGGGAGGGG + Intergenic
965281171 3:166754794-166754816 ATATATGACAAGGAGCATAGAGG - Intergenic
966160100 3:176958705-176958727 CTGCATTCCAAGCAGCAGAATGG - Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
967529930 3:190537311-190537333 CTGTGTGGCAAGAAACAGAGAGG - Intronic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
970264249 4:14263794-14263816 CTTGAAGACAAGCAGCATAGTGG - Intergenic
970408099 4:15782867-15782889 CTGTGTGACAGGCAGGAGAGGGG - Intronic
974160913 4:58137706-58137728 GTGTATGTCAGGCATCAGAGTGG - Intergenic
974972983 4:68853963-68853985 CAATATGACCAGCTGCAGAGAGG - Intergenic
975185384 4:71396265-71396287 CTTGATGAAATGCAGCAGAGTGG + Intronic
975538446 4:75477069-75477091 CTCTATCACAAGCAGCAAAAGGG + Intergenic
975597759 4:76066568-76066590 TGGGATGACCAGCAGCAGAGAGG - Intronic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976588553 4:86826033-86826055 CTGTAAGCCAATCTGCAGAGAGG + Intronic
976775997 4:88706794-88706816 CTGGATGACAATCTGCAGACTGG - Exonic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
977564246 4:98565699-98565721 CTTTATCACAAGCAGCTGAGAGG + Intronic
978693888 4:111551970-111551992 CGTTATGACAGGAAGCAGAGTGG + Intergenic
978710695 4:111777061-111777083 CTTCATGACAATCAGAAGAGAGG - Intergenic
978884846 4:113756120-113756142 ATGTATGACTAACAGCTGAGAGG + Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979803356 4:124939270-124939292 CTTTATGTCATGGAGCAGAGTGG + Intergenic
980367037 4:131818194-131818216 CTGAATGAAAACCAGCAGATTGG + Intergenic
981396077 4:144251506-144251528 CTGTATGATGAACAACAGAGAGG - Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
984676955 4:182560432-182560454 TTGTAGGAGAAGCAGTAGAGGGG - Intronic
987377775 5:17252454-17252476 CTGTGTGCCATGCAGCAGAAAGG + Intronic
988727625 5:33939786-33939808 CTCTATGAAAGCCAGCAGAGGGG - Intergenic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991285438 5:64970150-64970172 CTGTAGGATAAGAAGAAGAGAGG + Intronic
993820934 5:92615700-92615722 CTGTATGACAATCAACACACAGG + Intergenic
995279365 5:110316194-110316216 CTGAATAACAAGCATCAGAATGG - Intronic
996430044 5:123364530-123364552 CTGCATTACAAGCAGCAGTGGGG - Exonic
999266680 5:150271125-150271147 CTGTGTGACTAGCAGCAGTCTGG - Intronic
1000242124 5:159418305-159418327 CAGTATTTCAAACAGCAGAGAGG + Intergenic
1001936386 5:175708814-175708836 CTTGATGACAAGCACCAGAGAGG - Intergenic
1002072385 5:176688001-176688023 TGGGATGACTAGCAGCAGAGAGG - Intergenic
1002796376 6:474265-474287 CTGTCTGACAAACAGCCCAGGGG + Intergenic
1002802886 6:543000-543022 CTGGATGATAAGCTGGAGAGTGG + Intronic
1003360786 6:5423253-5423275 CTCTCTATCAAGCAGCAGAGGGG - Intronic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1004955299 6:20722517-20722539 CATTATGACAGGAAGCAGAGTGG - Intronic
1005219601 6:23571794-23571816 ATGTGTCACATGCAGCAGAGAGG - Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1015944570 6:138486850-138486872 GTGTATCATAAGCAGCAGAATGG + Intronic
1017397348 6:154017711-154017733 CTGTATGAAAAATAGCAGAATGG - Intronic
1018671273 6:166179485-166179507 ATGTATGACAATCAGTTGAGGGG - Intergenic
1019446264 7:1073189-1073211 CTGTGTGTGAAGCTGCAGAGTGG - Intronic
1019511854 7:1421689-1421711 CTGGGTGACAAGCACCTGAGGGG + Intergenic
1021028620 7:15701613-15701635 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1021050669 7:15980821-15980843 TTTCATGACAAGGAGCAGAGAGG + Intergenic
1021262243 7:18472527-18472549 CTGTATCACAAAAAGCAGTGGGG - Intronic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029686729 7:102153546-102153568 CTGGTTGCCAAGCAGCAGGGAGG + Intronic
1029736597 7:102468877-102468899 CTGTGTGACCACCATCAGAGCGG - Exonic
1030538312 7:110796299-110796321 CTGGATGCCAAGCTTCAGAGAGG + Intronic
1031491631 7:122396758-122396780 TTGTATGACAAGAACCACAGTGG - Intronic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1034187605 7:149191084-149191106 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1034762824 7:153689565-153689587 TGGTAAGGCAAGCAGCAGAGGGG - Intergenic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1037817908 8:22121379-22121401 CTGCAGGAAAAGCAGTAGAGCGG - Intronic
1038114480 8:24538005-24538027 CTGTATAACACGCAGTTGAGAGG + Intergenic
1038359257 8:26861134-26861156 CTGTGTCACATGCAGCTGAGAGG - Intronic
1039609373 8:38906936-38906958 CTGTATGAAATACAGCAGACAGG - Intronic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1043185631 8:77145289-77145311 CTGTATGAAACACAGGAGAGTGG + Intergenic
1043968411 8:86504836-86504858 CTAAATAATAAGCAGCAGAGGGG - Intronic
1044361878 8:91295249-91295271 CTTTATGCCAATCTGCAGAGAGG + Intronic
1044580176 8:93818581-93818603 CTGTAAGTCAAGGAGCAGTGAGG + Intronic
1046038871 8:108878133-108878155 CTGTATGTCAAAAAGCAAAGGGG - Intergenic
1046657848 8:116914357-116914379 CTGTATGAAAAGATGAAGAGAGG - Intergenic
1048453198 8:134552721-134552743 CTATTTGTCAAACAGCAGAGAGG + Intronic
1049175639 8:141190824-141190846 CTCTGTGCCAAGCAGCCGAGGGG - Intronic
1049256984 8:141619418-141619440 CTGTATGAGAAGCAGCTGGGAGG - Intergenic
1049360757 8:142211595-142211617 CTGGGTGGCAAGCAGCAGAGAGG + Intergenic
1049374567 8:142282936-142282958 CTGTCTGTCAATGAGCAGAGGGG + Intronic
1049769556 8:144373591-144373613 CTGGAAGACAACCAGGAGAGTGG - Intronic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050920074 9:11189123-11189145 CTAGATGGCAAGAAGCAGAGAGG - Intergenic
1051358775 9:16263665-16263687 CTGAGTGACAAGCAGGGGAGCGG + Intronic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1059475882 9:114547249-114547271 CTGTATGCAAAGCCACAGAGAGG + Intergenic
1060259290 9:122059938-122059960 CACTATGACAAGCAGCTGTGGGG - Intronic
1061266416 9:129507873-129507895 CTCTTTGGCCAGCAGCAGAGGGG - Intergenic
1061709648 9:132478844-132478866 ATGAATGACAAGCTGCAGAGCGG - Intronic
1061777423 9:132974772-132974794 CTGGATGACAAGAAGGAGACAGG + Intronic
1062005044 9:134234828-134234850 GTGTATGCCAAGGTGCAGAGGGG - Intergenic
1186225510 X:7395156-7395178 CTGTGTGTCTAGCAGTAGAGAGG + Intergenic
1190278508 X:48914295-48914317 CTGTAGGCCAAGAAGCAGAGAGG + Intronic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1190650998 X:52568689-52568711 ATGTATGGCAAGCACCAAAGTGG - Intergenic
1191672878 X:63765296-63765318 CTTTCTGAGAAGCAGCTGAGGGG - Intronic
1192789644 X:74368778-74368800 CTGTATGTCTAGAAGCAAAGAGG + Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1194761808 X:97803905-97803927 CTGTCTGACAAGCCCCAGTGAGG + Intergenic
1195083454 X:101391763-101391785 CGTTATGACAGGAAGCAGAGTGG + Exonic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1196483212 X:116175338-116175360 CTGTGTGAACAACAGCAGAGAGG - Intergenic
1198553570 X:137769330-137769352 CTGTCTGACAAGCCGCAGTGAGG + Intergenic
1198722856 X:139642732-139642754 CTGAATTACAAGGAGCAGAAGGG - Intronic
1199309734 X:146308663-146308685 CTGTATGACAAATAGCAGTGTGG + Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic