ID: 1128501651

View in Genome Browser
Species Human (GRCh38)
Location 15:68230945-68230967
Sequence AGCCCTCAAGCCGCTGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128501647_1128501651 -6 Left 1128501647 15:68230928-68230950 CCTGTCTCCTCTCACCCAGCCCT 0: 1
1: 0
2: 9
3: 113
4: 960
Right 1128501651 15:68230945-68230967 AGCCCTCAAGCCGCTGCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 143
1128501646_1128501651 -1 Left 1128501646 15:68230923-68230945 CCAGTCCTGTCTCCTCTCACCCA 0: 1
1: 0
2: 5
3: 112
4: 628
Right 1128501651 15:68230945-68230967 AGCCCTCAAGCCGCTGCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 143
1128501644_1128501651 26 Left 1128501644 15:68230896-68230918 CCAGGCGCACACGACATGTGCAG 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1128501651 15:68230945-68230967 AGCCCTCAAGCCGCTGCAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128501651 Original CRISPR AGCCCTCAAGCCGCTGCAGA AGG Intronic
915543879 1:156585010-156585032 AGCCCCCAACACCCTGCAGAGGG - Intronic
916442583 1:164842116-164842138 AGCCCTGCAGCCGCTGCTCAGGG + Intronic
918704340 1:187641670-187641692 ATGGCTCAAGGCGCTGCAGAAGG + Intergenic
920305316 1:205014806-205014828 AGTCCTCATGCCCCTGCACATGG + Intronic
921554656 1:216583539-216583561 AGCCATGAAGCCCCTGTAGAGGG - Intronic
922401873 1:225267849-225267871 AACCCTCAAGCCAAGGCAGAGGG + Intronic
923462917 1:234222641-234222663 AGCCCTCAGGCTGCAGGAGAGGG + Intronic
923490425 1:234478968-234478990 CGTCCTCGAGCCGCTGCAGAAGG + Exonic
1066563294 10:36692771-36692793 AACACTCAAGCCTCTGCAGGCGG + Intergenic
1069535972 10:69253374-69253396 TGCTCCCAAGCCCCTGCAGAAGG - Intronic
1070204544 10:74243296-74243318 AGCGCTCAACCCCCTGCAGGAGG - Intronic
1070371373 10:75785463-75785485 AGCCATCATGCCCCTGCAGGAGG - Intronic
1072801789 10:98397348-98397370 CACCCTCAAGCCCCTGCTGAAGG - Exonic
1075654237 10:124150938-124150960 AGCCCCCAAGCCGAGGCAGCTGG + Intergenic
1075782284 10:125025068-125025090 AGCCCTGAAGCAGCTGTAGGCGG - Intronic
1076720151 10:132388893-132388915 AGCCCCCGAGCCCCTGCAGGCGG - Intergenic
1076776597 10:132701363-132701385 AGCCCTCAGGAGCCTGCAGATGG - Intronic
1077763406 11:5129548-5129570 AGCCCTCTAGCTGCTGTAGGTGG + Intergenic
1077810728 11:5633818-5633840 AGTCCTCAAGAGGCTGAAGAAGG + Exonic
1080682385 11:34488922-34488944 ATCCCCCAGGCTGCTGCAGATGG + Intronic
1081155053 11:39680058-39680080 GGCCCTCCACCCTCTGCAGATGG - Intergenic
1081380403 11:42407682-42407704 AGCCCTGAAGCTGCAGCAGGAGG + Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1084101827 11:66954980-66955002 AGGCCTCCAGCCCATGCAGAAGG + Intronic
1088151438 11:106750094-106750116 AGCCTTCAGTCTGCTGCAGAAGG + Intronic
1090419955 11:126567839-126567861 TGCCCTCAAGTAACTGCAGATGG + Intronic
1090660113 11:128876136-128876158 AGGCCTCAGGGCACTGCAGAGGG - Intergenic
1091873166 12:3912036-3912058 GGCCCTCAAGCTTCTGCACATGG - Intergenic
1092199345 12:6570440-6570462 AGCCCGCCAGCTCCTGCAGATGG + Exonic
1092272749 12:7036744-7036766 AGCTCTCACGTCACTGCAGAAGG + Intronic
1094088955 12:26626671-26626693 AGGCAGCATGCCGCTGCAGAAGG - Intronic
1096465900 12:51847752-51847774 AACCCCCCCGCCGCTGCAGAGGG - Intergenic
1104151677 12:126090475-126090497 AGCCACCAAGCCCCTGCAGTGGG - Intergenic
1104960272 12:132485273-132485295 AGGTCTCAAGCCCCTGCGGAGGG + Intergenic
1108258977 13:48638134-48638156 CTCCCTCAAGCCCCTTCAGAAGG - Intergenic
1108555217 13:51584732-51584754 ACCCCTCCATCCGCTGCAGCAGG - Exonic
1113581266 13:111431133-111431155 AGCTCTCAAGCAGCTACTGATGG + Intergenic
1113804566 13:113105871-113105893 AGCCCTGAAGCCCAAGCAGAAGG - Exonic
1117620308 14:57579279-57579301 ACCACTCAACCCACTGCAGATGG + Intronic
1118696857 14:68394261-68394283 AGCCCAGCAGCCCCTGCAGATGG - Intronic
1119303931 14:73591982-73592004 AGCCCCCAGGCCGCTGCTGCTGG + Exonic
1119895771 14:78218809-78218831 AGCCCTCAAACCAATACAGAGGG - Intergenic
1122552832 14:102559294-102559316 AGCCCTCAGGACCCTGCAGTGGG - Intergenic
1122721489 14:103724918-103724940 AGCCCCCAATGCGCTGCTGAAGG + Intronic
1122942800 14:104989956-104989978 TGTCCTCAAGCCCCTGTAGAGGG - Intronic
1125723335 15:41855637-41855659 TGGCCTCCAGCCGCCGCAGAAGG + Exonic
1126957635 15:53951945-53951967 ATCCCTCAAGCCTCTGTAAATGG + Intergenic
1128182712 15:65618878-65618900 AGGCCTCTGGCCGCTCCAGAAGG + Intronic
1128501651 15:68230945-68230967 AGCCCTCAAGCCGCTGCAGAAGG + Intronic
1129019499 15:72503774-72503796 AGCCCTCAACCCCTTGCAGGAGG + Intronic
1129449104 15:75640036-75640058 AGTCCTCCCGCCGCTGCAGCCGG + Exonic
1131440376 15:92455063-92455085 GGCCCTCAAGTCTCTGCAGCAGG - Intronic
1132038168 15:98503551-98503573 AGCCCTCAAGCTTCAGCAGAAGG + Intronic
1132403843 15:101530458-101530480 AGTCCTCAAGCAGCAGCACAGGG - Intergenic
1132852906 16:2032887-2032909 AGCCCCCAAGGCCCTCCAGATGG - Intronic
1134634164 16:15779552-15779574 AGCCCTCTAGCCCCTGAATATGG - Intronic
1136069694 16:27780441-27780463 AGCCCTCACTGAGCTGCAGATGG + Intergenic
1136448670 16:30339859-30339881 AGGCCTCAGGTGGCTGCAGAGGG - Intergenic
1137731623 16:50694210-50694232 AGCCCTCATGCAGCTTCAGGAGG - Intronic
1139505701 16:67397120-67397142 CTCCCTCAAGTCACTGCAGATGG + Intronic
1139552838 16:67685198-67685220 AGCCATCAAGGGGCTGGAGATGG - Intronic
1141962889 16:87421274-87421296 AGCCCTTAAGACGTTGCAGGAGG + Intronic
1142426566 16:90004747-90004769 AGCCCTCAGGCTGCTGCAGCTGG + Intergenic
1142957735 17:3532680-3532702 TGGCCTCACGCCGCTGCAGCTGG - Exonic
1143175995 17:4955405-4955427 AGCCCTGGAGCTGCTGAAGACGG + Exonic
1143408716 17:6695868-6695890 TGCCCTCAAGGTGCTGCAGGAGG - Exonic
1143459677 17:7094158-7094180 TGCCTTCACGCCGCTACAGAAGG + Intergenic
1146282700 17:31555319-31555341 TGCCCTCAAGCAGCAGCAGAGGG - Intergenic
1148216556 17:45836651-45836673 AGCCCTCAACCCGCAGCTGATGG - Intergenic
1148331869 17:46818282-46818304 AGTCCTCCAGCCCCTGCAGCGGG + Intronic
1150225418 17:63522251-63522273 AGCTCTCAGGCCTCTGAAGAAGG + Intergenic
1152127950 17:78458732-78458754 AGCCCTGCTGCCGCTGCAGGGGG - Intronic
1152224282 17:79085532-79085554 AGGCCCCAAGCCACAGCAGAAGG - Intronic
1154303328 18:13213484-13213506 ACCCCACAAGACGCTGCAAACGG + Intergenic
1155297972 18:24402643-24402665 AGACATCACGCTGCTGCAGAAGG - Intergenic
1159997340 18:74978927-74978949 AGCCCTCACGCCTCTCCCGATGG - Intronic
1162062278 19:8103468-8103490 AGCCTTCAAGCCTATGGAGAGGG - Intronic
1165040510 19:33064807-33064829 GGCCCCCCAGCCGCTGGAGAAGG - Exonic
1166336129 19:42108709-42108731 CGCCCTCAAGTGGCTTCAGAGGG - Intronic
925165448 2:1713139-1713161 AGTCCCCAAGCCGCTGCACAAGG + Intronic
926473651 2:13293873-13293895 AGCCATGAGGCCACTGCAGAGGG + Intergenic
928652900 2:33421075-33421097 AGACCGCAAGCCACTGCAGCTGG + Intergenic
929341472 2:40824028-40824050 AGAACTCAAGATGCTGCAGAAGG + Intergenic
930094486 2:47556584-47556606 TGCCCTCAAGCAGCTGAATATGG - Intronic
935680892 2:105636113-105636135 AGCCCTCAGATTGCTGCAGAGGG + Intergenic
936524631 2:113234378-113234400 AGGCCTCAACCAGCTACAGATGG + Intronic
937079145 2:119127900-119127922 AGCTCTCCAGCTGCTGCGGAGGG + Intergenic
945170437 2:206989552-206989574 AGCCCTCTAGCGGCTGGGGAAGG + Intergenic
948179663 2:235969806-235969828 AGCCCGCCAGCCTCCGCAGAAGG + Intronic
948483207 2:238263270-238263292 AGCACTCAGGCCCCAGCAGAGGG - Intronic
1170961497 20:21029581-21029603 ACCCCTTAGGCTGCTGCAGAAGG - Intergenic
1172871553 20:38138662-38138684 AGCCCTCGAGCAGCTCAAGAAGG - Intronic
1172890609 20:38261019-38261041 AGGCCTCGAGCCGCAGCAGCCGG + Intronic
1172896338 20:38302921-38302943 AGGCCTGAGGCTGCTGCAGAGGG + Intronic
1175821219 20:61909951-61909973 AGCCCTGCAGCCACGGCAGAGGG - Intronic
1175826113 20:61937570-61937592 AGCCCTTCAGCCCCAGCAGAAGG + Exonic
1175945283 20:62555718-62555740 AGGCCTCCAGCCGCTGCAGGAGG - Intronic
1176032030 20:63017344-63017366 AGCCCTCAGTGGGCTGCAGAGGG + Intergenic
1179728787 21:43355797-43355819 GGCCCTGAGGCCGCTGGAGAGGG + Intergenic
1181570628 22:23766239-23766261 TGCCCCCCAGCCCCTGCAGATGG - Exonic
1182421409 22:30250452-30250474 ACCTCTCAAGCCTCTGCTGATGG + Intergenic
1183300331 22:37056040-37056062 AGCCCTAAAGCTGCCCCAGACGG + Intronic
1184296923 22:43530716-43530738 AGCCCTCTACCTGCTGCCGAAGG - Intronic
1184652859 22:45927071-45927093 AGCCCCCAGGCCTCTGCAGATGG + Intronic
1185043460 22:48517458-48517480 AGCCCTCAGGCAGCTGAGGAAGG - Intronic
950106862 3:10393942-10393964 ACCCCACAAGCCACAGCAGAAGG - Intronic
953063475 3:39447862-39447884 GGCCCACAAGCCGCTGGAGCTGG - Intergenic
953151379 3:40328440-40328462 AGCCCTCAGGAGGCTGCAGAGGG - Intergenic
958504156 3:94952601-94952623 TGCCCTAAAGCCACTGCAAATGG + Intergenic
963657521 3:148076041-148076063 AGCCCTCCAGCCACAGCATATGG + Intergenic
965862409 3:173162566-173162588 ATCTCTCAAGCCCCTGCATATGG + Intergenic
973408144 4:49772221-49772243 AGGCCTCAAAGCGCTGCAAATGG - Intergenic
976168101 4:82276211-82276233 AGCCCTCCAGCCTCTGGAGGGGG + Intergenic
985480351 5:106672-106694 AGCCCTCACCCTGCTGCAGGGGG - Intergenic
985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG + Intergenic
986353506 5:6902650-6902672 AGCACTCAAGGCTCTGCAGGTGG + Intergenic
989985211 5:50689384-50689406 AGGCCTCAACCAGCTGAAGATGG - Intronic
997362660 5:133305192-133305214 AGCCTGCAAGCCGCTGGAGAGGG - Intronic
1001668451 5:173453572-173453594 AGCCCTTAAGCAGCTGGAGATGG - Intergenic
1003674679 6:8192339-8192361 AGGCCTCTAGCGGATGCAGAAGG + Intergenic
1017690709 6:156961457-156961479 AGCCAGCAAGCCGCTGCTGGCGG - Intronic
1017979298 6:159385571-159385593 AGCCCAGAAGCAACTGCAGAGGG - Intergenic
1020082725 7:5295521-5295543 TGGCCTCCAGCCCCTGCAGAGGG + Intronic
1021955736 7:25822766-25822788 AGCTCTCAAGCCCCCCCAGAGGG - Intergenic
1023255887 7:38311661-38311683 TGCCCCCCAGCCCCTGCAGATGG + Intergenic
1023478764 7:40610131-40610153 AGGCCCCAAGCCACTCCAGAAGG - Intronic
1026830245 7:73606126-73606148 AGCTCTCTAGCGGCTGCTGACGG - Intronic
1029458496 7:100682765-100682787 GGCCCCCAAGCTGCTACAGATGG + Exonic
1032539081 7:132688364-132688386 GGCCATCAAGTGGCTGCAGAAGG - Intronic
1035669774 8:1408473-1408495 AGCCCCCATGGCCCTGCAGAGGG + Intergenic
1036080863 8:5553950-5553972 GGCTCTCAAGGCGCTGCTGAGGG + Intergenic
1036280451 8:7395890-7395912 AGCCCTCAAGCCCGTGAAGCTGG - Intergenic
1036341019 8:7915680-7915702 AGCCCTCAAGCCCATGAAGCTGG + Intergenic
1036668687 8:10765529-10765551 GGCCCTCAGGCGGCTGCACATGG + Exonic
1045383006 8:101645443-101645465 AGTACTCAAGCCTATGCAGATGG - Intronic
1046770340 8:118111612-118111634 AGTCTTGGAGCCGCTGCAGAAGG - Exonic
1046876827 8:119264157-119264179 AGCCCACAGGCAGCTGCTGATGG + Intergenic
1048991007 8:139760137-139760159 AGCCCCCAAGCCACTGGAGTAGG - Intronic
1049276367 8:141722025-141722047 AGCCCTGAAGCAGCTTCTGAGGG + Intergenic
1050016437 9:1238927-1238949 AGCCCACAAGCAATTGCAGATGG + Intergenic
1053950969 9:43384493-43384515 AGGCCTCAAAGCGCTGCAAATGG - Intergenic
1053951147 9:43387555-43387577 AGGCCTCAAAGCGCTGCAAATGG - Intergenic
1053951267 9:43389422-43389444 AGGCCTCAAAGCGCTGCAAATGG - Intergenic
1053967557 9:43672416-43672438 AGGCCTCAAAGCGCTGCAAATGG - Intergenic
1054029584 9:44746097-44746119 AGGCCTCAAAGCGCTGCAAATGG - Intergenic
1056702492 9:88922383-88922405 AACCCTCACGTCTCTGCAGATGG - Intergenic
1058973203 9:110101727-110101749 AGCATGCAAGCAGCTGCAGATGG - Intronic
1060588105 9:124799416-124799438 GGGCCTCCAGCTGCTGCAGAAGG + Exonic
1203596211 Un_KI270747v1:141696-141718 AGGCCTCAAAGCGCTGCAAATGG - Intergenic
1185616934 X:1427748-1427770 AGCCCTCAATCAGCTCCAGGAGG + Exonic
1186393080 X:9180849-9180871 AGCCCTCAACCAGTGGCAGATGG + Intergenic
1195942057 X:110175013-110175035 TGCCCGCAGGCCTCTGCAGAAGG - Exonic
1198261486 X:134968991-134969013 AGCCCACAAGACACAGCAGATGG + Intergenic
1198265178 X:135002142-135002164 AGCCCACAAGACACAGCAGATGG - Intergenic
1199445272 X:147912671-147912693 AGCCCTCTTGGCGCTGCAGGAGG - Intronic
1200281323 X:154779326-154779348 AGCCCTGCAGCAGCTGCAGAAGG - Exonic
1200292746 X:154887379-154887401 AGCCATCAAGTCGCTGCAGGTGG + Exonic
1200339590 X:155383119-155383141 AGCCATCAAGTCGCTGCAGGTGG + Exonic
1200346880 X:155457574-155457596 AGCCATCAAGTCGCTGCAGGTGG - Exonic