ID: 1128502010

View in Genome Browser
Species Human (GRCh38)
Location 15:68233249-68233271
Sequence AAAGATCTTTGTCTTAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 187}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128502010_1128502022 20 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502022 15:68233292-68233314 AACACCTACGGGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 13
4: 169
1128502010_1128502020 18 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502020 15:68233290-68233312 GAAACACCTACGGGGGGGTGGGG 0: 1
1: 1
2: 0
3: 5
4: 99
1128502010_1128502013 9 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502013 15:68233281-68233303 TCAATGTATGAAACACCTACGGG 0: 1
1: 0
2: 0
3: 6
4: 129
1128502010_1128502021 19 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502021 15:68233291-68233313 AAACACCTACGGGGGGGTGGGGG 0: 1
1: 1
2: 0
3: 13
4: 139
1128502010_1128502017 13 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502017 15:68233285-68233307 TGTATGAAACACCTACGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 39
1128502010_1128502019 17 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502019 15:68233289-68233311 TGAAACACCTACGGGGGGGTGGG 0: 1
1: 0
2: 1
3: 2
4: 59
1128502010_1128502023 21 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502023 15:68233293-68233315 ACACCTACGGGGGGGTGGGGGGG 0: 1
1: 0
2: 3
3: 32
4: 286
1128502010_1128502026 25 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502026 15:68233297-68233319 CTACGGGGGGGTGGGGGGGGTGG 0: 1
1: 1
2: 27
3: 300
4: 3933
1128502010_1128502016 12 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502016 15:68233284-68233306 ATGTATGAAACACCTACGGGGGG 0: 1
1: 0
2: 1
3: 1
4: 62
1128502010_1128502018 16 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502018 15:68233288-68233310 ATGAAACACCTACGGGGGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 63
1128502010_1128502012 8 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502012 15:68233280-68233302 CTCAATGTATGAAACACCTACGG 0: 1
1: 0
2: 2
3: 13
4: 126
1128502010_1128502015 11 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502015 15:68233283-68233305 AATGTATGAAACACCTACGGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1128502010_1128502024 22 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502024 15:68233294-68233316 CACCTACGGGGGGGTGGGGGGGG 0: 1
1: 1
2: 0
3: 46
4: 560
1128502010_1128502014 10 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128502010 Original CRISPR AAAGATCTTTGTCTTAGCCC AGG (reversed) Intronic