ID: 1128502010

View in Genome Browser
Species Human (GRCh38)
Location 15:68233249-68233271
Sequence AAAGATCTTTGTCTTAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 187}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128502010_1128502013 9 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502013 15:68233281-68233303 TCAATGTATGAAACACCTACGGG 0: 1
1: 0
2: 0
3: 6
4: 129
1128502010_1128502017 13 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502017 15:68233285-68233307 TGTATGAAACACCTACGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 39
1128502010_1128502019 17 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502019 15:68233289-68233311 TGAAACACCTACGGGGGGGTGGG 0: 1
1: 0
2: 1
3: 2
4: 59
1128502010_1128502026 25 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502026 15:68233297-68233319 CTACGGGGGGGTGGGGGGGGTGG 0: 1
1: 1
2: 27
3: 300
4: 3933
1128502010_1128502023 21 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502023 15:68233293-68233315 ACACCTACGGGGGGGTGGGGGGG 0: 1
1: 0
2: 3
3: 32
4: 286
1128502010_1128502016 12 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502016 15:68233284-68233306 ATGTATGAAACACCTACGGGGGG 0: 1
1: 0
2: 1
3: 1
4: 62
1128502010_1128502018 16 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502018 15:68233288-68233310 ATGAAACACCTACGGGGGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 63
1128502010_1128502012 8 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502012 15:68233280-68233302 CTCAATGTATGAAACACCTACGG 0: 1
1: 0
2: 2
3: 13
4: 126
1128502010_1128502015 11 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502015 15:68233283-68233305 AATGTATGAAACACCTACGGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1128502010_1128502014 10 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1128502010_1128502020 18 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502020 15:68233290-68233312 GAAACACCTACGGGGGGGTGGGG 0: 1
1: 1
2: 0
3: 5
4: 99
1128502010_1128502024 22 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502024 15:68233294-68233316 CACCTACGGGGGGGTGGGGGGGG 0: 1
1: 1
2: 0
3: 46
4: 560
1128502010_1128502021 19 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502021 15:68233291-68233313 AAACACCTACGGGGGGGTGGGGG 0: 1
1: 1
2: 0
3: 13
4: 139
1128502010_1128502022 20 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502022 15:68233292-68233314 AACACCTACGGGGGGGTGGGGGG 0: 1
1: 0
2: 1
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128502010 Original CRISPR AAAGATCTTTGTCTTAGCCC AGG (reversed) Intronic
901409539 1:9072493-9072515 GAAGGTCTTTGCCGTAGCCCAGG + Intronic
902220756 1:14963155-14963177 AAAGATCTTTGGCCTTGCCCAGG + Intronic
904085700 1:27906072-27906094 AAAAATCTTTGTTCTAGGCCGGG + Intronic
909265059 1:73547661-73547683 AAAGATCATTCTCTGATCCCTGG - Intergenic
909595921 1:77405983-77406005 AAAGATTTATGTTTTAGCCAGGG - Intronic
910651875 1:89577155-89577177 AAAGATCTGTCTCTGACCCCAGG - Intronic
911082859 1:93950379-93950401 GAAGATCTCTGACATAGCCCTGG + Intergenic
911150013 1:94589561-94589583 AAAGATCTTTCTCTTCTCCTAGG + Intergenic
911420766 1:97637564-97637586 AAAGAGCTTTGCCTTAGACCAGG + Intronic
912649267 1:111423720-111423742 AGAGTTCTTTGCCTTACCCCTGG - Intronic
912886822 1:113483607-113483629 AAACATCTCTGTCTTAGTCTGGG - Intronic
913294006 1:117301133-117301155 AAAAATCTTTGTAGTAGGCCAGG - Intergenic
916449242 1:164903933-164903955 AAAGAGCATTGTCCTAGGCCCGG - Intergenic
916484075 1:165242370-165242392 AAAGAGCCTTGCCTTAGCCAAGG + Intronic
917186507 1:172362609-172362631 AAAGATGTTTCTTTTAGGCCAGG - Intronic
918305670 1:183243786-183243808 AAAAAACTTTGACTTTGCCCAGG + Exonic
918653852 1:186999733-186999755 ACTGTACTTTGTCTTAGCCCTGG - Intergenic
919226725 1:194713565-194713587 AAAAATCTTTGTCTTCTCCCAGG - Intergenic
921307375 1:213810434-213810456 CAAGCTCTATGTCTTAACCCAGG - Intergenic
921745109 1:218731635-218731657 AAAGATCTTTGTGTTATACCGGG - Intergenic
1063037989 10:2306911-2306933 AAAGCCTTTTGTCTTAGTCCAGG + Intergenic
1063739260 10:8799011-8799033 AAAGATGTTTGTCTTAGTTGGGG - Intergenic
1064684692 10:17848075-17848097 AAACATCATTGTTTAAGCCCAGG - Intronic
1065184151 10:23156149-23156171 AATGATCTTAGTCTGAGCCAAGG + Intergenic
1065465922 10:26021828-26021850 AAAGCTCTTTTACTTAGACCAGG - Intronic
1066335556 10:34473981-34474003 AAAGGTCCTTGTGTTTGCCCAGG - Intronic
1068587698 10:58817686-58817708 AAACATCTGTGTATTTGCCCAGG - Exonic
1068698602 10:59995849-59995871 CAAGATCTTTGTCTAAGCCCTGG + Intergenic
1068830456 10:61488596-61488618 AAAGATCTTTGTTTAAGCCTTGG - Intergenic
1069989812 10:72308342-72308364 AGAGATCTGTCTCTTAGCCAAGG + Intergenic
1071951956 10:90713257-90713279 CATGATGTTTGTCTAAGCCCTGG - Intergenic
1073027931 10:100501954-100501976 GAAGGTCTTTGCCTTGGCCCTGG + Intronic
1074489253 10:113924283-113924305 AAAGATTTTGGTCTTTGCCCTGG + Intergenic
1076247706 10:128960492-128960514 AAAGATCATTGTGAGAGCCCAGG + Intergenic
1076255733 10:129023036-129023058 AAACATCTTTCTTTTAGCCTAGG - Intergenic
1079589389 11:22163932-22163954 AAAGATCTGGGTCTCAGCCTGGG + Intergenic
1079659023 11:23017490-23017512 AAAGATATTTACCATAGCCCTGG - Intergenic
1081400861 11:42641182-42641204 AAAAATCTTTGTCTTACCTATGG + Intergenic
1084983870 11:72850358-72850380 AAAAATCTCTGTCCTAGGCCTGG - Intronic
1087555018 11:99707536-99707558 AAATATCTAGGTCTTAGCCCAGG + Intronic
1088354184 11:108924833-108924855 AAAGAGCTTTTTCTTAGTCTAGG + Intronic
1089822951 11:121245388-121245410 AAAAAGCTTTTTCTTAGGCCGGG - Intergenic
1090533142 11:127612034-127612056 AAAGATCTTTGTTTTCCTCCAGG - Intergenic
1090611083 11:128471356-128471378 AAAGACCTTTGTTTTTGCTCTGG + Intronic
1091643423 12:2254833-2254855 AAAGATCTTTTTCTTGGCAGTGG - Intronic
1092856205 12:12675857-12675879 TAAGATCTTGATTTTAGCCCTGG + Intronic
1092943471 12:13431980-13432002 CAAGATCGTTGTCATAGTCCAGG - Intergenic
1093122481 12:15288873-15288895 AAAAATCTTTGCCTTACCCTAGG - Intronic
1093287123 12:17277715-17277737 TCAGATCTTTTTCTTATCCCAGG + Intergenic
1093899487 12:24613998-24614020 AAGCATCTTTGTCTTGCCCCTGG - Intergenic
1097021770 12:56025835-56025857 AAAGATGTCTGGCTTGGCCCTGG - Intronic
1097165094 12:57080259-57080281 AAAGGTCCTTGTTTTAGACCAGG - Intronic
1098382018 12:69879449-69879471 AAATATCTTTTTCTTTACCCAGG - Intronic
1098659750 12:73076763-73076785 AAAGATTTTTGTCTTGGCTATGG + Intergenic
1100575236 12:95885241-95885263 GAAGATCTGTGTCTTAGGACTGG - Intronic
1103750781 12:123158934-123158956 AAATATCTTTGAATTAGGCCGGG + Intronic
1103966066 12:124640463-124640485 GCAGCTCTTTGTTTTAGCCCAGG + Intergenic
1104791706 12:131486814-131486836 CAGGATCTCTGTCTTAGCTCAGG + Intergenic
1109688077 13:65846531-65846553 AAAGATCTTTGCCTCAGCTCAGG + Intergenic
1110254946 13:73423100-73423122 CAAGGTCTTTGTCAAAGCCCTGG - Intergenic
1111526897 13:89483573-89483595 CAACAGCTTGGTCTTAGCCCAGG + Intergenic
1113438326 13:110309690-110309712 AAAGATCTAGGTATTAGCCTGGG + Intronic
1113679653 13:112234455-112234477 AAAGATCCTGGACTCAGCCCTGG - Intergenic
1114255996 14:21001746-21001768 AAATATCTTTGTCTTAGTCCAGG - Exonic
1114602640 14:23969123-23969145 AAATATCTTGGTCTTTGCCAAGG - Exonic
1114607009 14:24006252-24006274 AAATATCTTGGTCTTTGCCAAGG - Exonic
1114612318 14:24051220-24051242 AAATATCTTGGTCTTTGCCAAGG - Intergenic
1118642990 14:67809715-67809737 AAAGTACTTTATCTTAGGCCAGG - Intronic
1123414571 15:20085744-20085766 AAAAATCTTTAGCTGAGCCCAGG + Intergenic
1123523913 15:21092855-21092877 AAAAATCTTTAGCTGAGCCCAGG + Intergenic
1126870606 15:52982957-52982979 AAAGATGTTTGGCTCAACCCAGG + Intergenic
1126886596 15:53157837-53157859 AAATCTCTCTGTTTTAGCCCTGG + Intergenic
1128502010 15:68233249-68233271 AAAGATCTTTGTCTTAGCCCAGG - Intronic
1130065977 15:80605342-80605364 AAAGAGTTTTGTCCAAGCCCGGG + Intergenic
1132009501 15:98263277-98263299 AGAGATCTTTGCCTGTGCCCTGG - Intergenic
1134389627 16:13807540-13807562 AAAGGTCTTTATCTCAGCCCAGG + Intergenic
1137797378 16:51233459-51233481 CAAGATCTTTGTCACAGCCTTGG + Intergenic
1139414056 16:66792358-66792380 AAACATCTCTGTCTTATACCTGG - Intronic
1141421003 16:83915516-83915538 AATGATCGTTTTCTTAGCCGGGG - Exonic
1143755433 17:9063837-9063859 AAAGATTTTTTTTTTAGCCAAGG + Intronic
1145195715 17:20892814-20892836 AAATATCTTTTTCTTGGCCGGGG + Intronic
1148162008 17:45455612-45455634 AAAAATCTTGGTGTTACCCCAGG + Intronic
1148272726 17:46276230-46276252 AAAGTCCTTTGACTTAGTCCTGG - Intronic
1150393239 17:64802261-64802283 AAAAATCTTGGTGTTACCCCAGG + Intergenic
1150763285 17:67981681-67981703 AAAGTCCTTTGACTTAGTCCTGG + Intronic
1153825546 18:8870913-8870935 AAAGAGCTCTGTCTTTGCCTTGG - Intergenic
1155172155 18:23274823-23274845 AAACATCTTTAACTTAGGCCTGG + Intronic
1159864387 18:73687121-73687143 CAACATCTTTGTCTTAGGCCAGG - Intergenic
1167324938 19:48818566-48818588 CAAGATCCGTGTCTCAGCCCTGG - Intronic
1167553530 19:50177794-50177816 TAAGATCTTTGTCACAGGCCGGG - Intergenic
926100502 2:10113232-10113254 TAAGATCTTTGTTTAAGGCCGGG + Intergenic
926287276 2:11499338-11499360 AAAGATCATTCTCGTAGCACTGG - Intergenic
927715453 2:25349151-25349173 AGAGATCTTGGTCTTAGAGCTGG - Intergenic
927744139 2:25600392-25600414 AAAGATGTTTGCCATATCCCAGG - Intronic
928342323 2:30455602-30455624 TTAGATCTTTGTCTTAGGCTGGG + Intronic
930004662 2:46887030-46887052 AAAGATCATTTCCTGAGCCCAGG + Intergenic
934166166 2:89296233-89296255 AAAGCCCTGGGTCTTAGCCCCGG - Intergenic
934201109 2:89886223-89886245 AAAGCCCTGGGTCTTAGCCCCGG + Intergenic
935314559 2:101818780-101818802 AAAGGCCTTTGTCTCAGGCCAGG - Intronic
937300539 2:120837097-120837119 AAAAATCTTAATCTTAGGCCGGG + Intronic
939152334 2:138487645-138487667 AAAGTTCATGGGCTTAGCCCTGG - Intergenic
942176065 2:173335719-173335741 AAAGATCTCTGTCTTAGCTTAGG - Intergenic
943418194 2:187635422-187635444 AAAGTTGTCTGTCTTAGTCCTGG + Intergenic
943729773 2:191289807-191289829 AAAGATCTCTATCTTACCCTGGG + Intronic
944548932 2:200827717-200827739 TAAAATCTTTGTCTTTGCCTAGG + Intergenic
944769516 2:202899373-202899395 AAAGATCTTTCTGTTTGCCATGG + Intronic
946599410 2:221342998-221343020 TAAGATCTTTGTATTAGCCAGGG + Intergenic
1173444248 20:43103383-43103405 AAAGAGATTTGTCTCAGCCAGGG - Intronic
1174961262 20:55159758-55159780 AGATATCTTTGTCTTATTCCTGG + Intergenic
1178377578 21:32080235-32080257 AAAGAAGTGGGTCTTAGCCCTGG - Intergenic
1182545537 22:31073820-31073842 AAAAATCTTTAGCTGAGCCCAGG - Intronic
1182611798 22:31554177-31554199 TAAGAACTTTGCCTTAACCCAGG + Intronic
949270476 3:2210575-2210597 AAAAATCCATGTCTTAGCCTTGG + Intronic
949314867 3:2741598-2741620 AAAAATCTTTGATTTAGCCTTGG - Intronic
950138576 3:10600194-10600216 AAATATCTTTCTCTTGGCCTAGG + Intronic
950419642 3:12891147-12891169 AAAGACCTTTCTCTTAGCAGGGG + Intergenic
955010929 3:55013595-55013617 AAAGATGTATGTCTCAGCTCAGG - Intronic
955858793 3:63304546-63304568 AAAGATTTTTGTCTTTCTCCTGG + Intronic
958764056 3:98343532-98343554 AAAGATCTCAGTCTCAGCACAGG + Intergenic
960173109 3:114486163-114486185 AAAGATCTGAATCTTAGCACAGG - Intronic
960981648 3:123233780-123233802 AGACATCTTTGTCTTGTCCCTGG - Intronic
961146108 3:124594645-124594667 AAAGATCTATTTCTTAACCCAGG - Intronic
961166622 3:124767974-124767996 AAAGAGGTTTGCCTGAGCCCAGG + Intronic
961702574 3:128757811-128757833 AAAAATATTTTTCTTAGGCCAGG - Intronic
961853917 3:129850367-129850389 AAACATCTATGTCTTAGGTCTGG - Intronic
965405154 3:168259269-168259291 AAAGTCATTTGTCTTTGCCCAGG - Intergenic
965830315 3:172778888-172778910 AAAGATTGCTGTCTTAGGCCGGG - Intronic
969198942 4:5586321-5586343 ACACATCTTTGACTTATCCCAGG + Intronic
969744678 4:9060794-9060816 AATCATCTTTATCTTAGCCCTGG + Intergenic
972390334 4:38607445-38607467 ATAGTGCTATGTCTTAGCCCAGG - Intergenic
974638889 4:64603924-64603946 AAAGACTTTGGTCTTATCCCAGG - Intergenic
975151466 4:71026934-71026956 AAGGATCTTTATTTTAGCTCAGG - Intronic
978144395 4:105354775-105354797 TAAAATCTTTGGCTTAGGCCGGG - Intergenic
981198423 4:141947589-141947611 AAATTTCTTTGTGTTAGGCCAGG - Intergenic
986709915 5:10481134-10481156 AAAGTCCTTTGTCTCTGCCCCGG - Intergenic
987138829 5:14924822-14924844 AAAGAGTATTGTCTTGGCCCTGG - Intergenic
989260495 5:39414350-39414372 TAAGACCTTTGGCTTAGCACTGG - Intronic
989560793 5:42848173-42848195 AAAAGTCTTTGTCTAAGCCAAGG - Intronic
990086951 5:51990357-51990379 AAAGACCTTTGTCTCAGCATGGG + Intergenic
990514835 5:56521358-56521380 AAAGAGCTTTGTCTTGCCTCTGG + Intronic
992311537 5:75505874-75505896 AAGGATCTTTATCTTATCCACGG + Intronic
994135983 5:96287141-96287163 AAAGATGTTTGTCTCATCTCAGG - Intergenic
994818668 5:104619447-104619469 AAAGATCTTTGTCTTAGGCAAGG + Intergenic
996906981 5:128611979-128612001 AAATGTCTTTATCTTATCCCTGG - Intronic
998167063 5:139850191-139850213 AGAGCTCTTTGTCTCATCCCTGG - Intronic
999503451 5:152170074-152170096 AAAGACCTTTTTCTAAACCCTGG - Intergenic
1000080322 5:157839303-157839325 AAAGAACTTTGTCCCAGGCCAGG + Intronic
1002558844 5:180066531-180066553 AAAAAGATTTGTCTTAGCCTGGG + Intronic
1002861852 6:1086461-1086483 AAAGAGCTTTGTCTTTGCATTGG - Intergenic
1003045136 6:2726940-2726962 ACAGAAATTTGTTTTAGCCCAGG - Intronic
1003166564 6:3684378-3684400 AAATATCTGGGTCTTAGCCCAGG + Intergenic
1005726528 6:28654672-28654694 AAAGATTTTTATCTTTGGCCGGG + Intergenic
1006421237 6:33935488-33935510 CAGGATCTCTGTCTGAGCCCAGG + Intergenic
1007894019 6:45329423-45329445 AAAGATCTTTATAGTTGCCCAGG + Intronic
1010918795 6:81654459-81654481 AAAGATCTATGTCTGAGGCCAGG - Intronic
1012420190 6:99056444-99056466 AAAGGTCTTTGTATTAGTCAGGG - Intergenic
1012607869 6:101181001-101181023 AAATATTTATGTCTTAGCCAGGG + Intergenic
1014273072 6:119355435-119355457 ACAGAACCTTGTCTTAGCCTTGG + Intergenic
1014375765 6:120671075-120671097 GGAGATCTTGGTCTGAGCCCAGG + Intergenic
1014732369 6:125048219-125048241 AAAGATCTTAGTCTCAGTACAGG - Intronic
1015948664 6:138529184-138529206 AGAGATCTTTCTCTGACCCCTGG - Intronic
1016333158 6:142975058-142975080 AAAGATCTTCATCTGATCCCTGG - Intergenic
1016560591 6:145391885-145391907 AGAGATATTTCTCTTGGCCCTGG + Intergenic
1016712476 6:147189634-147189656 AAACATATCTGTCTTAGCTCTGG + Intergenic
1018218365 6:161552679-161552701 AAAGTTCTGTGTCTTGGCCTGGG - Intronic
1024132038 7:46362949-46362971 GAAAATTATTGTCTTAGCCCGGG - Intergenic
1024521989 7:50313672-50313694 AAAGCTATTTCTCTTAGCCTTGG + Intronic
1026064632 7:67059396-67059418 AAAAATCTTTGTCTTTGGCCAGG - Intronic
1026542617 7:71293862-71293884 AAAATTCTTTGTCTTTGGCCAGG + Intronic
1026713669 7:72767309-72767331 AAAAATCTTTGTCTTTGGCCAGG + Intronic
1026736067 7:72949469-72949491 GAAGATCTTTGCCTTTGACCTGG - Exonic
1026786415 7:73304386-73304408 GAAGATCTTTGCCTTTGACCTGG - Exonic
1027107662 7:75415592-75415614 GAAGATCTTTGCCTTTGACCTGG + Intergenic
1030925090 7:115441962-115441984 AAAGACCTTTGTTTGAGTCCTGG + Intergenic
1031268157 7:119609142-119609164 AAAGATATTTTTCTTAGAGCAGG + Intergenic
1033039260 7:137903385-137903407 ATACAGTTTTGTCTTAGCCCTGG - Intronic
1033501746 7:141957931-141957953 AGAGATGTTTTTCTTATCCCTGG - Intronic
1034093192 7:148382657-148382679 AAGAATCTTTGTGTGAGCCCAGG + Intronic
1034651344 7:152693217-152693239 AGAAATCATGGTCTTAGCCCGGG - Intergenic
1035646746 8:1228861-1228883 CAAGATCTTTGTCTTGCTCCCGG - Intergenic
1038713397 8:29970323-29970345 AAAAATCTTAGTCTTAACCAGGG - Intergenic
1039789109 8:40860066-40860088 AAAGATCTATGTCTTGCTCCAGG - Intronic
1040615466 8:49032557-49032579 AAACAACTTTGTCAGAGCCCTGG - Intergenic
1047227807 8:122971251-122971273 AAAGTGCTTTCTCTTAGGCCAGG - Intronic
1047264307 8:123291701-123291723 AAAGTTCTTTTTCTTACCTCTGG - Intergenic
1047557064 8:125943591-125943613 AAAGATCTTGGTCTTGAGCCAGG - Intergenic
1048273730 8:133049950-133049972 AAAGCTATTTCTCTTAGCACTGG - Exonic
1051485701 9:17605584-17605606 AGAGATGTTTCTCTTAGCCCAGG + Intronic
1052246732 9:26346218-26346240 GAACATCTTTGTCTTATTCCTGG - Intergenic
1055104943 9:72502448-72502470 ACAGATCTAGGTCCTAGCCCTGG - Intergenic
1055888645 9:81098001-81098023 AGAGATCTTAGTCTTAGTCCTGG - Intergenic
1057759203 9:97859180-97859202 AAAGTTCTTTCTCTTTGACCAGG - Intergenic
1058455953 9:105138386-105138408 AAGGGTCTTTGTCTGAGGCCAGG + Intergenic
1058579667 9:106441196-106441218 AAACATCTTAGGCTTAGGCCTGG - Intergenic
1059721071 9:116960564-116960586 ATAGTTCTTTATTTTAGCCCTGG + Intronic
1185953570 X:4464178-4464200 ACACAGCTTTTTCTTAGCCCAGG + Intergenic
1186023208 X:5280149-5280171 AAAGCTCTTTGTATTAGCCAAGG - Intergenic
1188638191 X:32462726-32462748 AAAGAGCATTGTTTGAGCCCAGG + Intronic
1188945605 X:36297657-36297679 AAGGTACATTGTCTTAGCCCTGG - Intronic
1189101802 X:38198225-38198247 AAAGATCATTTCCTTAGCTCTGG + Intronic
1189237456 X:39498184-39498206 AGAGATCTGTGTTATAGCCCCGG - Intergenic
1192422376 X:71045157-71045179 AATGATTTTTGTGTTACCCCAGG - Intergenic
1193655654 X:84194046-84194068 AAAAATCTTTGCCTTAACCAAGG + Intergenic
1194373852 X:93109120-93109142 AAAGATATTTATTTTAGCTCAGG + Intergenic
1195060923 X:101193863-101193885 AAAAATCTTTGTTTTGGCCAGGG + Intergenic
1195422172 X:104687686-104687708 AAAAATTTCTGTCTTTGCCCTGG + Intronic
1195682332 X:107557524-107557546 AAAAATCTTTGTCTAACCCAAGG + Intronic
1196055682 X:111352282-111352304 CAAGATATTTACCTTAGCCCTGG + Intronic
1196665394 X:118310845-118310867 AAACATCTTTGGCTTGGCTCAGG - Intergenic
1197988415 X:132291847-132291869 AAAGATGATTGTCGTAGCACAGG + Intergenic
1200424670 Y:3007926-3007948 AACAATCTTTGTCTTTGACCAGG + Intergenic
1201730905 Y:17201776-17201798 AAAGAACTTTGTATTTGCCCAGG - Intergenic
1201979676 Y:19893056-19893078 AGAGTTCTTTCTCTGAGCCCTGG - Intergenic