ID: 1128502014

View in Genome Browser
Species Human (GRCh38)
Location 15:68233282-68233304
Sequence CAATGTATGAAACACCTACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128502010_1128502014 10 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128502014 Original CRISPR CAATGTATGAAACACCTACG GGG Intronic
902566392 1:17314407-17314429 CCATTTATGATACACCTACCTGG - Intronic
903466574 1:23556138-23556160 AAATGCATCACACACCTACGAGG - Intergenic
905761519 1:40562190-40562212 CAATGAAACAAACACCTACTTGG - Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
909153056 1:72033662-72033684 CAATGTATGAGACATCTAACTGG + Intronic
910222869 1:84906253-84906275 CAATGTATGAGACTCCTAGTTGG - Intergenic
915736237 1:158087382-158087404 CAATTTATTACACACCTACCAGG - Intronic
916653610 1:166852927-166852949 CAATTTATTCAACACCAACGAGG + Exonic
920802719 1:209204593-209204615 CAATTTATGAAACTCCCACAAGG + Intergenic
923355389 1:233150015-233150037 CAATGAAAGAAACACATAGGGGG - Intronic
924167447 1:241299333-241299355 AAATGTATGAATCATCTAGGAGG - Intronic
1071692622 10:87838180-87838202 GAATGCATGAAACAGCTACTTGG - Intronic
1078888948 11:15536337-15536359 CAATGTAGGAAACAACTACCAGG + Intergenic
1079234620 11:18679320-18679342 CAATGTATAAAACCCCAAGGTGG + Intergenic
1082805336 11:57445650-57445672 TAATTTATGAAACAACTACTGGG - Intergenic
1086908968 11:92450161-92450183 CAATGAATGAAACCTCAACGAGG - Intronic
1093230367 12:16536324-16536346 CTGTGTATGAAAAAACTACGTGG + Intronic
1095673131 12:44884317-44884339 AAATGTATGAAACATTTACCTGG + Intronic
1099359414 12:81681290-81681312 CAAGGTGTGAAAAACCTAAGTGG + Intronic
1103249554 12:119487789-119487811 CTTTGTATTAAACACCTACAAGG - Intronic
1104209959 12:126679180-126679202 AAATGTATGAAACAGCTTCATGG + Intergenic
1105551717 13:21403437-21403459 AAATGTATGGAACACCTGCTAGG + Intronic
1109681097 13:65754358-65754380 CAATGCAGAAAAAACCTACGTGG - Intergenic
1116345750 14:43791190-43791212 CAATGTCTGAAACAACTACATGG + Intergenic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1123163796 14:106306556-106306578 CAATGTAAGAAAGACATAAGGGG - Intergenic
1125104250 15:35952254-35952276 CAATGTATGCTAAACCTAAGTGG - Intergenic
1127734434 15:61828294-61828316 CTATGTTTGAAACACTTACCAGG - Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1134105131 16:11479933-11479955 CAATTTATAAAAAACATACGTGG - Intronic
1142053825 16:87979206-87979228 CAATGTATGTAACACGTCTGAGG + Intronic
1151373480 17:73665928-73665950 GGATTTATGAAACACCTACTAGG - Intergenic
1152023351 17:77793360-77793382 CATTGTCTGAAACCCCTGCGTGG + Intergenic
1154055568 18:11010164-11010186 CCATGTACCAAACACCTACTAGG + Intronic
1159222914 18:65488612-65488634 CAATGTATCACACTCCCACGTGG - Intergenic
1160700613 19:505206-505228 CAATGTATGTAAAAAGTACGTGG - Exonic
927729860 2:25461661-25461683 CAATGTACGGAGCACCTACTAGG + Intronic
939395259 2:141621126-141621148 CAATGTATGTAAAACATATGAGG - Intronic
940928166 2:159392104-159392126 CACTGTATGACACACCTGTGTGG + Intronic
942647046 2:178123607-178123629 CAATGAAGGAAACACCTATTCGG - Exonic
1172588509 20:36101574-36101596 CAATTTGTGAAACACCTAAAAGG + Intronic
951909252 3:27731761-27731783 CAATGTCTGACACACATACTAGG - Intergenic
953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG + Intronic
955519692 3:59763044-59763066 CAATATCTGAAACACCGGCGGGG - Intronic
971339585 4:25755598-25755620 AAATGTATGAAAGAACTATGGGG + Intronic
971381416 4:26101889-26101911 CAATATACGAAGCACCTACAGGG + Intergenic
975609017 4:76185672-76185694 CAATTTATCAAACACCTCTGAGG - Intronic
977033362 4:91916777-91916799 CAATGAATGAAACACAGACATGG + Intergenic
984081160 4:175251901-175251923 AAATGTTTGAAATACCTACAAGG + Intergenic
992301488 5:75386667-75386689 CAATTTATGAAGGACCTATGGGG + Intronic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
1004488954 6:16095547-16095569 CAATTTAAGAGACACCTAAGCGG - Intergenic
1008765604 6:54910152-54910174 CCATCTATGAAACAGCTAGGTGG - Intronic
1009197743 6:60707485-60707507 CAATGTATTAGACACCTCTGGGG + Intergenic
1010170787 6:72972729-72972751 CAATTTATTGAACACCTACTAGG - Intronic
1011085719 6:83538230-83538252 CAGTGTATGAAACATCTTTGGGG - Intergenic
1016024621 6:139273385-139273407 CAATTTATGAAACACCTGTAGGG - Intronic
1016321880 6:142855176-142855198 CAATAGATGAACCACCCACGTGG + Intronic
1035138798 7:156736474-156736496 CAAAGTGTCAAACACATACGTGG + Intronic
1035998926 8:4580117-4580139 AAATGTATTAAACACCTATGTGG + Intronic
1036062442 8:5339065-5339087 CAATGTAAGAAACATAAACGCGG + Intergenic
1046446492 8:114327671-114327693 CAATATATGAAAATCCAACGTGG - Intergenic
1048372291 8:133789718-133789740 AAATGTATTTAACACCTACTTGG - Intergenic
1056980854 9:91309957-91309979 CACTGGATGAGACACCTAGGGGG - Intronic
1061804927 9:133132553-133132575 CACTGTAGGAAACACCTTCTCGG - Intronic
1186786341 X:12959502-12959524 TAATCTATCAAACACCTACTGGG + Intergenic
1187382455 X:18816594-18816616 TAATGGATGAAACAACTAGGTGG - Intronic
1187588734 X:20692596-20692618 GAATGTATTAAACACCTCCGGGG + Intergenic
1188027679 X:25227555-25227577 CAAAATATGAAACTCCTACAAGG + Intergenic
1193512158 X:82416396-82416418 AAATGTATGGAACACTTACTAGG - Intergenic
1194680166 X:96842563-96842585 CCATGTATAAAATACCTACTAGG + Intronic
1198607806 X:138362272-138362294 CAATACATGAAAAACCTACATGG + Intergenic