ID: 1128502014

View in Genome Browser
Species Human (GRCh38)
Location 15:68233282-68233304
Sequence CAATGTATGAAACACCTACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128502010_1128502014 10 Left 1128502010 15:68233249-68233271 CCTGGGCTAAGACAAAGATCTTT 0: 1
1: 0
2: 3
3: 22
4: 187
Right 1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128502014 Original CRISPR CAATGTATGAAACACCTACG GGG Intronic