ID: 1128505939

View in Genome Browser
Species Human (GRCh38)
Location 15:68272788-68272810
Sequence CATAGGAGCCACACTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128505939_1128505944 -2 Left 1128505939 15:68272788-68272810 CCACACCCAGTGTGGCTCCTATG No data
Right 1128505944 15:68272809-68272831 TGCTTTTAATGACCATGTTTGGG No data
1128505939_1128505946 19 Left 1128505939 15:68272788-68272810 CCACACCCAGTGTGGCTCCTATG No data
Right 1128505946 15:68272830-68272852 GGAATCTTATTAGTATCAGATGG No data
1128505939_1128505947 20 Left 1128505939 15:68272788-68272810 CCACACCCAGTGTGGCTCCTATG No data
Right 1128505947 15:68272831-68272853 GAATCTTATTAGTATCAGATGGG No data
1128505939_1128505943 -3 Left 1128505939 15:68272788-68272810 CCACACCCAGTGTGGCTCCTATG No data
Right 1128505943 15:68272808-68272830 ATGCTTTTAATGACCATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128505939 Original CRISPR CATAGGAGCCACACTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr