ID: 1128507141

View in Genome Browser
Species Human (GRCh38)
Location 15:68281416-68281438
Sequence CAGCAAACCCATAATTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128507141 Original CRISPR CAGCAAACCCATAATTACAT GGG (reversed) Intronic
906177963 1:43792213-43792235 CAGCAAACCCATACTTGATTAGG - Intronic
906592163 1:47035466-47035488 CACAAGACCCATAATTACAAGGG - Intronic
906784699 1:48604470-48604492 CGGAAAACACATGATTACATGGG - Intronic
907531458 1:55102273-55102295 CAGTAAACATATAATTAAATAGG + Intronic
910026112 1:82655977-82655999 AAGCCATCCCATAACTACATTGG + Intergenic
910105072 1:83623425-83623447 CAACAAACCCATTGTTAGATGGG + Intergenic
910487640 1:87732938-87732960 CAGGAAACTCATAATCACAGTGG - Intergenic
910867749 1:91803589-91803611 CAGAAAACCCAAAATAACATTGG - Intronic
912064685 1:105722499-105722521 AAGCAAAGCCATTATTACCTGGG - Intergenic
912447567 1:109749502-109749524 CCTCAAATCCATAAGTACATTGG + Intronic
916396426 1:164393592-164393614 CAGCAAAACCAAAAATAAATAGG + Intergenic
916443003 1:164846108-164846130 CTGGAATCCCATAAATACATGGG + Intronic
916592939 1:166210779-166210801 CAGCTAACCTATAATACCATGGG - Intergenic
916638908 1:166705334-166705356 CAATAAATACATAATTACATTGG - Intergenic
917960105 1:180135626-180135648 CAGCACACCACTAATTACAGTGG - Intergenic
918140327 1:181714450-181714472 TAGCATGCCCATCATTACATAGG + Intronic
918551756 1:185750424-185750446 TAACAAAACCATAATTACAATGG - Intronic
919002874 1:191856849-191856871 CAGAAACTCCATACTTACATGGG + Intergenic
924413170 1:243828439-243828461 CAGCTGACCCTTAATAACATGGG + Intronic
1065372101 10:24997722-24997744 AAGCAAACCCAAAATTTCATTGG - Intronic
1068009984 10:51436217-51436239 CAGCAGAGCAATAATTACTTTGG - Intronic
1068403860 10:56564551-56564573 CACCAAACCCATACTGAAATAGG - Intergenic
1070525755 10:77294567-77294589 CAGCAAATGCATTCTTACATTGG - Intronic
1074384849 10:113008628-113008650 CATCAAACCTATAATTTCACAGG - Intronic
1075417355 10:122274500-122274522 CCGCAACCCCATAATCAAATGGG + Intronic
1091253244 11:134161647-134161669 CTGCAAACCCAACATTACCTTGG - Intronic
1095429541 12:42118138-42118160 CAGAAAACCCAAAATAACAGTGG - Intronic
1097631489 12:62069236-62069258 CAGCAAATCCCTAATGGCATAGG + Intronic
1098009182 12:66032264-66032286 CAGGAAACCGATAAGTAGATTGG + Intergenic
1100282596 12:93132230-93132252 CAGCAAAACCCTAATTAATTGGG + Intergenic
1100704229 12:97182765-97182787 CTGCAAAGCCATCATTAAATTGG - Intergenic
1102031446 12:109742192-109742214 CAGCAAACACATATGTACATAGG + Intronic
1108375711 13:49812102-49812124 CAGCAAACACATGATTTCCTGGG + Intergenic
1109189839 13:59310768-59310790 GAGAAAACCCATAAAGACATGGG + Intergenic
1111647367 13:91047585-91047607 CAGCAAACCAAAAATTACGAAGG + Intergenic
1117051585 14:51865746-51865768 CAGAAACTCCATATTTACATAGG - Intronic
1121444324 14:93969095-93969117 CACCAACCCCATAATAACACTGG - Intronic
1124228774 15:27922275-27922297 CAGTAAACCAAGAAATACATGGG + Intronic
1127025699 15:54803562-54803584 CAGAAAACCCAAAATGACAATGG + Intergenic
1128507141 15:68281416-68281438 CAGCAAACCCATAATTACATGGG - Intronic
1129525592 15:76211887-76211909 CAGAAAATCCCTAATTCCATCGG + Intronic
1131865461 15:96704001-96704023 CAGCAAAACCAGACTTAAATGGG - Intergenic
1133094680 16:3434884-3434906 CAGCAAAACAATATTTACATGGG - Exonic
1133100210 16:3474927-3474949 AAACAAACCCATAAATAAATGGG - Intronic
1137996664 16:53222641-53222663 CAGCAAACTCATTATTACATTGG + Exonic
1146193355 17:30789940-30789962 CAGAAAACTCATGATTACCTGGG + Intronic
1149346746 17:55745681-55745703 CAGCAAATTCATCATTACAGTGG - Intergenic
1149840297 17:59957908-59957930 CAGCAAAAACATACTCACATAGG - Intronic
1152255472 17:79236600-79236622 CACCAAACACATAATTATAGAGG + Intronic
1154015296 18:10610878-10610900 CCCCACACCCTTAATTACATAGG - Intergenic
1155884760 18:31194151-31194173 CAGCAAACACTAAAATACATAGG + Intergenic
1158755286 18:60316780-60316802 CAGCATGAGCATAATTACATAGG + Intergenic
1159839486 18:73381688-73381710 CATCAAACTCATTATTAGATGGG - Intergenic
1159910824 18:74144579-74144601 CAGCAAACTCAAAATTTCTTAGG + Intronic
1165317701 19:35066482-35066504 CAGCAGAACAATATTTACATGGG - Exonic
1167452366 19:49579154-49579176 CAACAAACCCACAGTTACACTGG + Intronic
925143732 2:1567590-1567612 CAGTAAACCAACAATTACACTGG + Intergenic
925495665 2:4446320-4446342 CAGCAAATCCATAACAACAGTGG - Intergenic
927526688 2:23749116-23749138 CAGTAAACCTACAAATACATTGG + Exonic
928526253 2:32144506-32144528 CAGCAAACCCATAGTTATGAGGG - Intronic
935181176 2:100692382-100692404 CAGCAAACCCGTGATCAAATCGG + Intergenic
939288662 2:140165115-140165137 AAGCAAACAAATAATTACATTGG - Intergenic
942046599 2:172102626-172102648 CACCACCCCCGTAATTACATTGG - Exonic
942783992 2:179678658-179678680 CAGAAAACCCAAAATAACAATGG - Intronic
944214258 2:197238565-197238587 CAGAAAACCCAAAATAACAGTGG + Intronic
1170147258 20:13189782-13189804 CAGCAATCCCATTATTAGATAGG + Intergenic
1170385914 20:15816790-15816812 CAGCAAGGCCATAAGTACATGGG - Intronic
1173776307 20:45709898-45709920 CAGCAAACCTAAAATTATGTTGG - Intergenic
1175081135 20:56421259-56421281 CATCAAACCTGTAATTTCATGGG + Intronic
1175381034 20:58564501-58564523 CAGCAGACCCACAAGTACAATGG - Intergenic
1179374705 21:40840235-40840257 CAAAAAACCCATAAATCCATAGG + Intronic
949826767 3:8173792-8173814 CAGCAATCCCATAACTAAATGGG + Intergenic
952079447 3:29740358-29740380 CAGCAAACTCAGAAATACAAGGG + Intronic
954875623 3:53801235-53801257 CATCATAACCATAATTCCATAGG + Exonic
955874130 3:63472415-63472437 CAGTAAGTCCATCATTACATTGG - Intronic
956533734 3:70252217-70252239 CTGCAAACCCATAGTTTCAGTGG + Intergenic
957425211 3:80029299-80029321 AAGCAAACCCATAAATAAGTGGG - Intergenic
963248199 3:143082381-143082403 CATCAAACCCACAATGTCATGGG + Intergenic
963982074 3:151549495-151549517 CTGCAAACCCTTAAATGCATAGG - Intergenic
964455238 3:156858032-156858054 AAGTAAACCAATAATTACAGAGG - Intronic
968679925 4:1910766-1910788 CAGCAAATCCACAATCCCATGGG - Intronic
970245580 4:14058923-14058945 CAGGAAACACATAATTTAATGGG - Intergenic
971609135 4:28699962-28699984 CAGCCAATCTAGAATTACATTGG - Intergenic
984362247 4:178749692-178749714 AAGCAAAACCATAATTGGATAGG + Intergenic
986380812 5:7183703-7183725 CAGAAAACCCAAAATAACAGTGG - Intergenic
989343069 5:40398502-40398524 AAGAAAAACCATAATTACAAGGG - Intergenic
990911395 5:60856008-60856030 CTGAAAACCCAAAATAACATAGG - Intergenic
991213790 5:64137499-64137521 CAGCTAAACAACAATTACATTGG + Intergenic
993588313 5:89760449-89760471 CAGCAATCCCAGTATTTCATGGG + Intergenic
994739149 5:103596273-103596295 CAGCAGACAAATAAATACATAGG - Intergenic
995065772 5:107860851-107860873 CTGCACACCATTAATTACATTGG + Exonic
999988191 5:157024576-157024598 CATCAAACCCATGATTTAATGGG - Intergenic
1005768744 6:29042676-29042698 CAAGAAACTTATAATTACATTGG + Intergenic
1006536947 6:34706908-34706930 CAGGAAAAACAAAATTACATTGG + Intergenic
1010775644 6:79881778-79881800 CAGAAAACCAATAATAAAATGGG + Intergenic
1010839500 6:80631744-80631766 CAGAAAACCCAAAATGACAAAGG + Intergenic
1010910939 6:81555355-81555377 GACCAATCCCATAATTCCATGGG - Intronic
1011648626 6:89484716-89484738 CAGAATACCCATAATGAGATTGG + Intronic
1012361028 6:98380498-98380520 AAGAAAACCCATAATTTGATAGG + Intergenic
1014019984 6:116575644-116575666 CAGAAAACCCCCAATAACATTGG + Intronic
1014074739 6:117223216-117223238 CAGCTACTCCAAAATTACATTGG + Intergenic
1015566089 6:134573288-134573310 CAGCCAAATCATAATTACACAGG - Intergenic
1015995539 6:138992507-138992529 AAGCAATCCTATAATTACTTTGG - Intergenic
1016520160 6:144937943-144937965 CTGCAGACCCATAATAACCTGGG + Intergenic
1017058232 6:150456708-150456730 CCGCAAAGCCATAAATACCTGGG - Intergenic
1017681215 6:156866004-156866026 CAGGCAACCAATAATTACTTGGG - Intronic
1022335287 7:29416011-29416033 CAGGAAACCCATTATTCCACGGG + Intronic
1028057454 7:86264242-86264264 CAGCACACTCATATTTACAATGG - Intergenic
1032538867 7:132687046-132687068 CAGCAAGCCCATCATTTCCTAGG + Intronic
1033680937 7:143595964-143595986 CAGTAAATCCATAATAGCATTGG - Intergenic
1033703955 7:143865849-143865871 CAGTAAATCCATAATAGCATTGG + Intronic
1035912167 8:3579500-3579522 AAGCAAATTTATAATTACATTGG + Intronic
1036002989 8:4630013-4630035 CAGCAAAACCATACTAATATGGG - Intronic
1041254462 8:55967723-55967745 CAGCAATTCTATGATTACATAGG - Intronic
1045836585 8:106528490-106528512 CAGGGAACCCCTAATTCCATAGG - Intronic
1045872641 8:106943772-106943794 AAGGAATCCCATGATTACATTGG + Intergenic
1046697774 8:117361035-117361057 CAGCTAACCCATAAGTGCAATGG + Intergenic
1050146758 9:2576368-2576390 CATCAAACCTATAATTACTGTGG + Intergenic
1050753305 9:8967279-8967301 CAGCAATCCCATTATTTGATTGG + Intronic
1050845193 9:10208111-10208133 CAGCAAAGTCCTCATTACATAGG - Intronic
1051590150 9:18769474-18769496 TAGAAAACCCAAAATAACATTGG + Intronic
1051814930 9:21094352-21094374 CACCAAAGTCTTAATTACATTGG + Intergenic
1053692631 9:40594065-40594087 AAACACACCCTTAATTACATAGG - Intergenic
1054272186 9:63043468-63043490 AAACACACCCTTAATTACATAGG + Intergenic
1054303873 9:63394983-63395005 AAACACACCCTTAATTACATAGG - Intergenic
1054402651 9:64721493-64721515 AAACACACCCTTAATTACATAGG - Intergenic
1054436262 9:65205824-65205846 AAACACACCCTTAATTACATAGG - Intergenic
1054794976 9:69292443-69292465 CAGAAAACCTAAAATAACATGGG - Intergenic
1055723246 9:79199188-79199210 CAGCAAAGCCATCATCACAAAGG - Intergenic
1055884206 9:81039978-81040000 CAGCAACTCCACAATCACATTGG + Intergenic
1057200956 9:93139781-93139803 CAGCAAACCACTAATGACAGGGG + Intergenic
1057877680 9:98770439-98770461 CTGCAAGCCCATAATAACTTTGG + Intronic
1188492929 X:30755417-30755439 AGACAAACCCATAATTACAGTGG + Intergenic
1189178198 X:38979132-38979154 CTACAAACCCATGAATACATAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190046405 X:47114431-47114453 CATCAAAGCCATATTTGCATTGG - Intergenic
1191611816 X:63123876-63123898 CAGCAAACACAAAAGTACAGAGG + Intergenic
1194435539 X:93864944-93864966 CAGCGACCCCAAAATTACAGTGG + Intergenic
1199573373 X:149289970-149289992 CAGGAAACGCATATTTACACAGG - Intergenic