ID: 1128508861

View in Genome Browser
Species Human (GRCh38)
Location 15:68301414-68301436
Sequence TTCACTGTAGCTTCTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 330}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128508861_1128508872 30 Left 1128508861 15:68301414-68301436 CCAAGGGCAGAAGCTACAGTGAA 0: 1
1: 0
2: 1
3: 32
4: 330
Right 1128508872 15:68301467-68301489 ATAGATGGAAGGGTGATCTTGGG 0: 1
1: 1
2: 0
3: 12
4: 178
1128508861_1128508869 20 Left 1128508861 15:68301414-68301436 CCAAGGGCAGAAGCTACAGTGAA 0: 1
1: 0
2: 1
3: 32
4: 330
Right 1128508869 15:68301457-68301479 CACACTGGCCATAGATGGAAGGG 0: 1
1: 0
2: 2
3: 7
4: 131
1128508861_1128508863 5 Left 1128508861 15:68301414-68301436 CCAAGGGCAGAAGCTACAGTGAA 0: 1
1: 0
2: 1
3: 32
4: 330
Right 1128508863 15:68301442-68301464 TAGGTCCTAACCGTCCACACTGG 0: 1
1: 0
2: 0
3: 1
4: 30
1128508861_1128508866 15 Left 1128508861 15:68301414-68301436 CCAAGGGCAGAAGCTACAGTGAA 0: 1
1: 0
2: 1
3: 32
4: 330
Right 1128508866 15:68301452-68301474 CCGTCCACACTGGCCATAGATGG 0: 1
1: 0
2: 0
3: 9
4: 73
1128508861_1128508868 19 Left 1128508861 15:68301414-68301436 CCAAGGGCAGAAGCTACAGTGAA 0: 1
1: 0
2: 1
3: 32
4: 330
Right 1128508868 15:68301456-68301478 CCACACTGGCCATAGATGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 152
1128508861_1128508871 29 Left 1128508861 15:68301414-68301436 CCAAGGGCAGAAGCTACAGTGAA 0: 1
1: 0
2: 1
3: 32
4: 330
Right 1128508871 15:68301466-68301488 CATAGATGGAAGGGTGATCTTGG 0: 1
1: 0
2: 1
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128508861 Original CRISPR TTCACTGTAGCTTCTGCCCT TGG (reversed) Intronic