ID: 1128508866

View in Genome Browser
Species Human (GRCh38)
Location 15:68301452-68301474
Sequence CCGTCCACACTGGCCATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128508861_1128508866 15 Left 1128508861 15:68301414-68301436 CCAAGGGCAGAAGCTACAGTGAA 0: 1
1: 0
2: 1
3: 32
4: 330
Right 1128508866 15:68301452-68301474 CCGTCCACACTGGCCATAGATGG 0: 1
1: 0
2: 0
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128508866 Original CRISPR CCGTCCACACTGGCCATAGA TGG Intronic
900755579 1:4432284-4432306 CTGTCCAGACTGGCCTTAGCTGG - Intergenic
902399176 1:16148518-16148540 CCGGCCACAGTGGCCAGGGAAGG + Exonic
902585444 1:17436472-17436494 CACTCCAGCCTGGCCATAGAGGG + Intronic
909577807 1:77195056-77195078 CTGTGCACACTGCCCATAGCAGG + Intronic
921309357 1:213827414-213827436 CACTCCACCCTCGCCATAGAGGG + Intergenic
1067272579 10:44805044-44805066 CTGACCACACTGGACACAGAAGG + Intergenic
1067287178 10:44915003-44915025 CCGTCCAGGCTGGGCATGGAGGG + Intronic
1069642320 10:69963881-69963903 CTGTCCACACTGGCCACCGCAGG - Intronic
1070603470 10:77881905-77881927 CTGTCCACAAAGGCCAAAGAGGG + Intronic
1071082452 10:81828638-81828660 CCATCTACCATGGCCATAGATGG + Intergenic
1077006676 11:361231-361253 CCTTCCACACAGGCCAAAGAAGG - Intergenic
1082002972 11:47403860-47403882 CCCTCCACTCTGGCAATCGAGGG - Intergenic
1083594006 11:63910458-63910480 ACGCCCACACTGGCCACTGAGGG - Exonic
1088821835 11:113463331-113463353 CCGTGCCCAATGGCCACAGATGG - Intronic
1091645709 12:2270870-2270892 CCCTCCAGCCTGGCCAGAGAGGG - Intronic
1095921818 12:47539434-47539456 CCATCCCTACTGCCCATAGATGG - Intergenic
1103080983 12:118023741-118023763 CCGCCCTCCCTGCCCATAGAAGG + Intronic
1103289661 12:119834661-119834683 CCTTCCACACTGACTATAAAAGG - Intronic
1104944386 12:132409219-132409241 CCGTCCACACCGTCCCCAGACGG + Intergenic
1106208908 13:27622646-27622668 CCATCCACACTGGCCACAAGGGG - Intronic
1106840576 13:33681995-33682017 TCGTCGACAATGGCCAGAGATGG - Intergenic
1112639346 13:101255380-101255402 CCCTCCACACTGGCAACAGCAGG - Intronic
1118743849 14:68760129-68760151 CAGCCCACCCTGGCCATAAACGG + Intergenic
1121765341 14:96481033-96481055 CCTACCACACAGGCCACAGAGGG - Intronic
1123144108 14:106111316-106111338 CCATCCACACTGACCCTACATGG - Intergenic
1123219365 14:106842050-106842072 GCTTCCACACTGGCAAGAGAGGG + Intergenic
1124036033 15:26054359-26054381 GTGTCCACACTGGCCATGGGGGG - Intergenic
1124335823 15:28856392-28856414 CAGACCACACTGGCCATTGAAGG + Intergenic
1124336356 15:28860235-28860257 CAGGCCACACTGGACATTGAGGG - Intergenic
1125005371 15:34811013-34811035 CCGTCCACTCTGGCCATCACTGG - Intergenic
1128508866 15:68301452-68301474 CCGTCCACACTGGCCATAGATGG + Intronic
1132535364 16:476552-476574 GGGTCCACACTGGCCAGGGAAGG + Intronic
1134483972 16:14642135-14642157 CCGCCCACACTGGCCATGCAGGG - Intronic
1135429769 16:22373816-22373838 CCCTCCACGCTGGCCATGAAAGG + Intronic
1142232800 16:88907636-88907658 CCTTCCCCACTGGCCACAGAGGG + Intronic
1144670937 17:17132227-17132249 CCTTGCACACTGGCCAGGGAGGG - Intronic
1146319928 17:31839196-31839218 CCATCCACAAAGGCCATAGTAGG + Intergenic
1147118678 17:38322133-38322155 CCGGCCAAACCGGTCATAGATGG - Exonic
1147782268 17:42952037-42952059 CCCTCCACACTGGCCCACGAGGG + Intronic
1149979983 17:61303021-61303043 CCTTTCAGACTGGCCATGGAAGG + Intronic
1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG + Intronic
1159723243 18:71919675-71919697 CCAGCCACATTGGCCATAGTTGG + Intergenic
1167242043 19:48349878-48349900 AGGTCGACACTGGCCATAGGTGG + Intronic
926434771 2:12826620-12826642 CCATCCACACTGGCCTAAGCTGG - Intergenic
932862814 2:75312157-75312179 CCTTTCACACTGGCCATACAGGG - Intergenic
937448672 2:121981718-121981740 CAGTCCACCCTGGCGACAGAGGG - Intergenic
945306839 2:208266616-208266638 CCGTCCCCACTCGCCAGACAAGG - Intronic
946434754 2:219644151-219644173 CCGCCCTCCCTTGCCATAGATGG - Intergenic
947220412 2:227786366-227786388 TCTTCCATACTGGCCATAAAAGG - Intergenic
948225810 2:236308557-236308579 GCCCCCACACTGGCCACAGAGGG - Intergenic
948699965 2:239753331-239753353 CTGTCCCCACTGGCCAGACACGG - Intergenic
948797667 2:240413041-240413063 CCCACCACACTGGCCAGAGAAGG + Intergenic
1170608302 20:17890487-17890509 ACTTGCACACTGGCCATTGATGG - Intergenic
1175174436 20:57102483-57102505 CCTTCCACACTGGAGATAGGGGG - Intergenic
1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG + Intronic
1181869214 22:25884715-25884737 CCCTCCAAACTGGACATACAAGG - Intronic
1182484258 22:30629963-30629985 CCCTCCACCCTGGCCACAGGTGG + Intergenic
1182744946 22:32598296-32598318 ACCCCCACACTGGCCTTAGAAGG + Intronic
950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG + Exonic
952256724 3:31701977-31701999 CTATGCACAGTGGCCATAGAGGG - Intronic
965511771 3:169575602-169575624 ACCTCCACACTGGACTTAGAAGG + Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985797517 5:1974016-1974038 CCGTCTACACCAGCCAAAGAAGG + Intergenic
990988214 5:61660642-61660664 CCTTCCTCTCTGGCCATGGAGGG - Intronic
991628445 5:68629331-68629353 CTGTCCACACTGGCAATGGCAGG + Intergenic
1001894999 5:175371088-175371110 CACTCCAGACTGGCAATAGAGGG + Intergenic
1008661951 6:53677809-53677831 CTGTCCACATTGGCCAAGGATGG + Intergenic
1017266408 6:152451306-152451328 CCATTCACACTGGCCCTAAAAGG - Intronic
1023861463 7:44219812-44219834 CAGTCCACACTGGCCAGAGCTGG - Intronic
1029415905 7:100443114-100443136 ATGTCCACACTGGGCATAGAAGG + Intergenic
1035315888 7:157997482-157997504 CCATCCACACTGGCCCTGCAAGG + Intronic
1036980603 8:13466053-13466075 ATGTCCTCACTGGGCATAGACGG + Intronic
1042494810 8:69444111-69444133 CCATATTCACTGGCCATAGAAGG - Intergenic
1045370339 8:101516445-101516467 CCCTCCAGCCTGGCCACAGAGGG - Intronic
1049322202 8:142002487-142002509 CCGTGGACAATGGCCAGAGAAGG - Intergenic
1049549711 8:143251420-143251442 CCGTCCACACTGCTCCTGGATGG - Intronic
1050399477 9:5236136-5236158 GCCTCCACACTGTCCATACATGG + Intergenic
1059531685 9:115041057-115041079 CCGTCCACAGTTACCATGGAGGG + Exonic
1060768403 9:126312245-126312267 CCAGCCACACTGGCCCTTGAAGG - Intergenic
1189010965 X:37045417-37045439 CCTGCCACACTGGCCAATGAGGG - Intergenic
1191841549 X:65516849-65516871 CCTTCCACCCTGTCCATACAAGG + Intronic
1195533270 X:105982172-105982194 CCGTCCTGAGTGGCCAAAGAGGG - Intergenic
1195575000 X:106439549-106439571 CCTTACACACTGGCTATAGATGG + Intergenic