ID: 1128508866

View in Genome Browser
Species Human (GRCh38)
Location 15:68301452-68301474
Sequence CCGTCCACACTGGCCATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128508861_1128508866 15 Left 1128508861 15:68301414-68301436 CCAAGGGCAGAAGCTACAGTGAA 0: 1
1: 0
2: 1
3: 32
4: 330
Right 1128508866 15:68301452-68301474 CCGTCCACACTGGCCATAGATGG 0: 1
1: 0
2: 0
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128508866 Original CRISPR CCGTCCACACTGGCCATAGA TGG Intronic