ID: 1128510977

View in Genome Browser
Species Human (GRCh38)
Location 15:68313763-68313785
Sequence TCACCAGGTGGGCCGGGCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 339}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128510977_1128510985 6 Left 1128510977 15:68313763-68313785 CCGGAGCCCGGCCCACCTGGTGA 0: 1
1: 0
2: 1
3: 38
4: 339
Right 1128510985 15:68313792-68313814 CGTCAGCCTCGTATTTGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 31
1128510977_1128510990 19 Left 1128510977 15:68313763-68313785 CCGGAGCCCGGCCCACCTGGTGA 0: 1
1: 0
2: 1
3: 38
4: 339
Right 1128510990 15:68313805-68313827 TTTGAGGTGGAAGCGTAAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 129
1128510977_1128510988 17 Left 1128510977 15:68313763-68313785 CCGGAGCCCGGCCCACCTGGTGA 0: 1
1: 0
2: 1
3: 38
4: 339
Right 1128510988 15:68313803-68313825 TATTTGAGGTGGAAGCGTAAGGG 0: 1
1: 0
2: 0
3: 1
4: 92
1128510977_1128510984 3 Left 1128510977 15:68313763-68313785 CCGGAGCCCGGCCCACCTGGTGA 0: 1
1: 0
2: 1
3: 38
4: 339
Right 1128510984 15:68313789-68313811 GGACGTCAGCCTCGTATTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1128510977_1128510989 18 Left 1128510977 15:68313763-68313785 CCGGAGCCCGGCCCACCTGGTGA 0: 1
1: 0
2: 1
3: 38
4: 339
Right 1128510989 15:68313804-68313826 ATTTGAGGTGGAAGCGTAAGGGG 0: 1
1: 0
2: 1
3: 4
4: 124
1128510977_1128510987 16 Left 1128510977 15:68313763-68313785 CCGGAGCCCGGCCCACCTGGTGA 0: 1
1: 0
2: 1
3: 38
4: 339
Right 1128510987 15:68313802-68313824 GTATTTGAGGTGGAAGCGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128510977 Original CRISPR TCACCAGGTGGGCCGGGCTC CGG (reversed) Exonic