ID: 1128511506

View in Genome Browser
Species Human (GRCh38)
Location 15:68316448-68316470
Sequence CCTTCTCTGCAGGAGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 309}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128511492_1128511506 21 Left 1128511492 15:68316404-68316426 CCTGGTCTCACCCTCACGAGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 309
1128511498_1128511506 -4 Left 1128511498 15:68316429-68316451 CCAGGAGACCTCAGCGGCCCCTT 0: 1
1: 0
2: 1
3: 16
4: 170
Right 1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 309
1128511497_1128511506 -3 Left 1128511497 15:68316428-68316450 CCCAGGAGACCTCAGCGGCCCCT 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 309
1128511494_1128511506 11 Left 1128511494 15:68316414-68316436 CCCTCACGAGGTTTCCCAGGAGA 0: 1
1: 0
2: 1
3: 27
4: 288
Right 1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 309
1128511495_1128511506 10 Left 1128511495 15:68316415-68316437 CCTCACGAGGTTTCCCAGGAGAC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 309
1128511491_1128511506 22 Left 1128511491 15:68316403-68316425 CCCTGGTCTCACCCTCACGAGGT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG 0: 1
1: 0
2: 1
3: 30
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128511506 Original CRISPR CCTTCTCTGCAGGAGTGGCT GGG Intronic
907496875 1:54851297-54851319 GCTGCTCTGCAGCAGGGGCTGGG - Exonic
907690406 1:56658908-56658930 CCTTCTCTTCCTGAGTGGCTGGG + Intronic
909851568 1:80471695-80471717 ACTTCTCTGAAAGTGTGGCTAGG + Intergenic
909956490 1:81785610-81785632 CCTTCGCTGCCTGAGTAGCTAGG - Intronic
910333864 1:86105840-86105862 CCTGTTCTCCAGGAGTCGCTGGG + Intronic
910749794 1:90616599-90616621 CATTCTCTGGAGCAGTTGCTGGG + Intergenic
911851074 1:102821972-102821994 CCTTATCTGGAGGACTGACTAGG + Intergenic
912372581 1:109185419-109185441 CAGGCTCTGCCGGAGTGGCTCGG - Intronic
912840705 1:113036761-113036783 CCCTCTGGGCAGGTGTGGCTGGG - Intergenic
912932844 1:113980191-113980213 CCTTTTCTGCAGGAGTGGAAGGG + Intronic
915041811 1:152974093-152974115 CCATCTCTGCATGAGTAGGTGGG + Intergenic
915736598 1:158089291-158089313 CCATCTCTGCAGGTGTGGGCAGG - Intronic
916499301 1:165373329-165373351 CCTGCTCTGCAGGAACAGCTTGG - Intergenic
917006165 1:170418975-170418997 CCTTCTCAGACGGGGTGGCTGGG - Intergenic
917008342 1:170441687-170441709 CCTTCTCTGCAGAATTGCCTTGG - Intergenic
917661887 1:177184950-177184972 GATTCTCTGGAGGAGGGGCTGGG - Intronic
919771986 1:201167513-201167535 CGTTATCTGCAGGAGTCACTGGG + Intronic
919876665 1:201874344-201874366 TCCACTCTGCAGGAGTGGCCTGG - Exonic
920925390 1:210336666-210336688 CCTTAGCTTCAGGAGTAGCTGGG - Intronic
922238445 1:223738880-223738902 CCTTCTCTGAGAGCGTGGCTCGG - Intronic
922556858 1:226539164-226539186 CCTTATCTGCAGGACTTGCTTGG + Intergenic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
1063662973 10:8046527-8046549 CCTTCTCGGCAGCAGCCGCTAGG - Intergenic
1064311779 10:14218270-14218292 CCTTCTCTGCTGGTGTGAATGGG - Intronic
1064595487 10:16940684-16940706 CCTTCTCTGCACATGTGCCTTGG - Intronic
1065410188 10:25417732-25417754 ACTTCTCTTCAGGAGTGTCTAGG - Intronic
1066335049 10:34467885-34467907 CCTTCTCTGCAGAAGAGCCTGGG - Intronic
1066372131 10:34826167-34826189 CCTTATCTGCAGAAGAGCCTGGG - Intergenic
1067431317 10:46247880-46247902 GCTTCTGTGCAAGCGTGGCTGGG + Intergenic
1068444931 10:57108708-57108730 CCTTCCCAGCAGCAGTGGCAAGG + Intergenic
1069623271 10:69850901-69850923 AGTCCTCTGCAGGAGTGCCTTGG - Intronic
1069878254 10:71576221-71576243 CCTGCTCTGCATGTGTGTCTGGG + Intronic
1070144101 10:73761152-73761174 CCTTCTGTGGAGCAGTGACTGGG + Intronic
1070232650 10:74586212-74586234 CCTTCTCTAATGGAGTGACTTGG + Intronic
1070443484 10:76469516-76469538 CAGTCTCTGGAGCAGTGGCTTGG + Intronic
1073112178 10:101069236-101069258 CCTTAGCTGCCGGAGTAGCTAGG - Intergenic
1075006694 10:118835812-118835834 CCATCTCTGCAGGGCTGGCCAGG - Intergenic
1075051014 10:119182473-119182495 CCTTCTCAGATGGGGTGGCTGGG + Intergenic
1075088520 10:119429993-119430015 CCTTCTGTGCAGGAAGGGGTGGG - Intronic
1075334186 10:121597298-121597320 CCTGCTCTGCCGCAGCGGCTGGG - Intronic
1075390323 10:122086769-122086791 CCTTTTCTCCAGGTGTGGCCAGG - Exonic
1075401807 10:122166389-122166411 CATTCTATGCAGGAGTGCATTGG + Intronic
1076276049 10:129199750-129199772 CCTTCTCTGAAGGAGGGAGTGGG - Intergenic
1076617248 10:131763534-131763556 CCTGCTCTGCGGGAGTCGGTGGG + Intergenic
1076814043 10:132905890-132905912 CCTTCCTTGCAGGTGGGGCTGGG - Intronic
1077563527 11:3281353-3281375 TCTTCCCTGCAGGTGAGGCTAGG - Intergenic
1077569418 11:3327168-3327190 TCTTCCCTGCAGGTGAGGCTAGG - Intergenic
1078985134 11:16586602-16586624 CCTTGTCCTCTGGAGTGGCTGGG - Intronic
1079323663 11:19473336-19473358 CATACTCTGCAGGAGGGGGTGGG + Intronic
1080014046 11:27486512-27486534 CCCCCTCTCTAGGAGTGGCTAGG - Intergenic
1080599833 11:33810443-33810465 CTTTCTCTGCTGGATTGGCTGGG - Intergenic
1081767625 11:45622472-45622494 CCTTCCCTGAAGGAGGGTCTGGG - Intergenic
1082220059 11:49623997-49624019 CATTGTCTCCTGGAGTGGCTAGG + Intergenic
1083591858 11:63900207-63900229 CCTTCTCTGAAGCTTTGGCTTGG - Intronic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1083971771 11:66081597-66081619 GGTTCTCTGAAGCAGTGGCTGGG + Intronic
1084429315 11:69102440-69102462 CCTTGAGTGCAGCAGTGGCTTGG + Intergenic
1084589433 11:70081834-70081856 CCTTCACAGCAGGAGTGTCCTGG - Intronic
1084784596 11:71434886-71434908 CCTGCTCTGCAGTCGTGGGTGGG - Exonic
1086416403 11:86592836-86592858 CCCTTTCTGAAGGAGTGACTAGG - Intronic
1086824271 11:91475831-91475853 CCTGCTGTGCTGGAGGGGCTGGG - Intergenic
1086970178 11:93073023-93073045 TGTTCTCTGCAGGAGTAACTGGG - Intergenic
1087137462 11:94735184-94735206 CCACCTCTGCAGCAGAGGCTGGG + Intronic
1088538882 11:110892053-110892075 CCTTCTCTCCATCAGTGGATTGG - Intergenic
1088792790 11:113241020-113241042 CCTTCCCTGAAGGAGAGGCGAGG + Intronic
1088916186 11:114229582-114229604 CCTTCTCTGAAGGACTGGAAAGG + Intronic
1090248068 11:125230981-125231003 CCCTCTCTGGAGGATTGGTTTGG + Intronic
1092843801 12:12566091-12566113 CCTTCTCAGACGGGGTGGCTGGG - Intergenic
1093129053 12:15367877-15367899 CCTTCACTCCAGGTGAGGCTTGG - Intronic
1093271560 12:17068615-17068637 CTTCATCTGCAGGATTGGCTTGG - Intergenic
1093680313 12:21994687-21994709 CTTTCTTTCCAGGAGTGGGTAGG + Intergenic
1097429404 12:59486019-59486041 CTTTCTCTGCCTGAGTGGCCTGG + Intergenic
1101566055 12:105906587-105906609 ACTGCCCTGCAGCAGTGGCTAGG + Intergenic
1101595901 12:106164074-106164096 CCTTCTCTGCAGGTCTGGTGGGG - Intergenic
1102037111 12:109777311-109777333 CCTTCACTGCAGAAGTGGTCTGG + Intergenic
1102490950 12:113289149-113289171 ACTTCTCTCCTGGAGTGGCTGGG + Intronic
1105068321 12:133218584-133218606 CCTTCTCTGCACGAGTGCCCCGG + Exonic
1105622862 13:22086180-22086202 CCTTCTGTGGAGGAGAGCCTGGG + Intergenic
1107165807 13:37280335-37280357 CCTTCTCAGATGGGGTGGCTGGG - Intergenic
1108076075 13:46680921-46680943 TCTACACTGCAGGAGTAGCTGGG + Intronic
1110928766 13:81188519-81188541 CCATTTCTCCAGGAGTGGCAAGG - Intergenic
1112891805 13:104243882-104243904 CCTTCACTGAAGCAGAGGCTGGG - Intergenic
1113457482 13:110458759-110458781 CCTCCTCTGCAGGTGACGCTGGG + Exonic
1113699149 13:112370904-112370926 CAATCTCTGCAGGAATAGCTGGG - Intergenic
1114317957 14:21524849-21524871 CTTTCTCTGCTGGAGGGGTTGGG - Exonic
1114879967 14:26772456-26772478 CTTGCTCTTCTGGAGTGGCTTGG + Intergenic
1115204714 14:30889625-30889647 TCTTCTCTGTTGGTGTGGCTTGG + Exonic
1116827396 14:49685953-49685975 ACTTCACTGCAGAAGTGGTTTGG - Intronic
1117496705 14:56312715-56312737 CCATTTCTGCAGGAGATGCTAGG - Intergenic
1118964209 14:70564237-70564259 CTTTCTCTTCAGGAGTGAGTGGG + Intergenic
1119168155 14:72513028-72513050 CCTTCTCCGCAGGATTGGTGAGG + Intronic
1120166632 14:81208240-81208262 CCCTTTCAGCTGGAGTGGCTGGG - Intronic
1122253280 14:100456229-100456251 CCGTCTCAGCCTGAGTGGCTGGG - Intronic
1122304259 14:100751730-100751752 CCCTCTCTGTCTGAGTGGCTCGG + Intergenic
1122523732 14:102364590-102364612 CCTCTTCTGAAGGAGTGACTAGG + Intronic
1122720084 14:103716688-103716710 CAATGTCTGCAGGAGTGGCCTGG - Intronic
1122726293 14:103756203-103756225 CCTGCTCAGCCTGAGTGGCTGGG + Intronic
1125381710 15:39092935-39092957 CCCTGTCTGCAGCAGTGGTTTGG + Intergenic
1125921325 15:43527497-43527519 CCTTCTCTGCAGATGTGTTTCGG - Exonic
1128071379 15:64799318-64799340 CCTTCTCAGACGGGGTGGCTGGG + Intergenic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1128680678 15:69649180-69649202 CCTTCTCTGCCAGAGCAGCTTGG - Intergenic
1129193998 15:73953492-73953514 CTTCCTCTGCAGGTCTGGCTGGG + Intergenic
1129230595 15:74195119-74195141 GCTGCTCTGCAGGAGAGGCAGGG - Intronic
1132007393 15:98241203-98241225 ACCTCTCTGCAGGAGAGGCTGGG - Intergenic
1132409465 15:101565670-101565692 CCTTCTCTGCAAGGGAGTCTGGG - Intergenic
1132573392 16:653764-653786 CCTTCTCTGCGGGGTTGGCAAGG + Exonic
1133119678 16:3598389-3598411 CCTTTTCTGCCGGTGTGGCCAGG - Intronic
1133738552 16:8633777-8633799 CCTTCTCTGCATGAGGCACTGGG - Intronic
1134303507 16:13012306-13012328 CCCTCTCTGCAGAAGTGACCTGG + Intronic
1134369024 16:13606428-13606450 CCTTCTCTGGTGGAGTGTATGGG - Intergenic
1134401364 16:13913442-13913464 GCTCCTCTGGAGGAGTGGCAGGG - Intergenic
1134872550 16:17665203-17665225 TCTTATCTGCAGGAGTAACTAGG - Intergenic
1137546866 16:49410816-49410838 CCTTCTCTGGAGGAGTCACAGGG + Intergenic
1137565124 16:49528006-49528028 GCTTGCCTGCAGGAGGGGCTTGG + Intronic
1137910217 16:52370375-52370397 CTTCCTCTGCAGCATTGGCTCGG + Intergenic
1138043372 16:53698084-53698106 CCTTCTCAGATGGGGTGGCTGGG - Intronic
1138657686 16:58500443-58500465 TCCTGTTTGCAGGAGTGGCTGGG + Intronic
1139512817 16:67437021-67437043 CCTCCTGTGCTGCAGTGGCTGGG - Exonic
1139528246 16:67529276-67529298 CCTTCGCCGCAGGGGAGGCTGGG + Intronic
1139750956 16:69108511-69108533 CATTGTTTCCAGGAGTGGCTGGG + Intronic
1141039046 16:80655784-80655806 CCTTCTCTCCAGGAGACGCAGGG + Intronic
1141712025 16:85705237-85705259 CCTTCACTGCACGAGAGGCCAGG - Intronic
1142130084 16:88428330-88428352 CCTTCCCTGCGGATGTGGCTGGG + Exonic
1145254125 17:21313563-21313585 CCTGCTCTTCAGGGCTGGCTGGG + Intronic
1146266875 17:31458575-31458597 CCTTCTCTGCACGGGAGCCTGGG + Intronic
1148114171 17:45165185-45165207 CCTTGTCTCCACCAGTGGCTTGG - Intronic
1149629475 17:58110475-58110497 CCTTCCCTGCAGGCAGGGCTGGG - Intergenic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1150913540 17:69413240-69413262 CCTTGTGTGCAGGAGTGGTGAGG - Intergenic
1151732127 17:75917832-75917854 CCAGCACTGCAGGAGCGGCTGGG - Exonic
1151855495 17:76718640-76718662 CCTTGTCTGCAGGACTGGACAGG + Intronic
1152323847 17:79624334-79624356 CCTTAGCTGCAGGGGAGGCTGGG + Intergenic
1152430267 17:80245038-80245060 CCTTCCCTGAAGGAGTGCGTAGG + Intronic
1152453201 17:80396784-80396806 CCCTCTCTGCAGGATATGCTGGG + Exonic
1152631509 17:81412711-81412733 TCTTCCCTGCATGAGTAGCTGGG + Intronic
1154138281 18:11800305-11800327 CCCTCACTGCAGGGGTGGATTGG - Intronic
1156463876 18:37336575-37336597 CCTGCTATGAGGGAGTGGCTGGG + Intronic
1157477201 18:48031011-48031033 TCCTCCCTGCAGGTGTGGCTTGG + Intronic
1159564326 18:70031896-70031918 CCCCCTCTGCAGGAGTTGTTGGG - Intronic
1160013788 18:75125756-75125778 CATTCTGTGCAGGTGGGGCTGGG - Intergenic
1160235749 18:77085363-77085385 CCTTCTCTGAATGTGTAGCTTGG + Intronic
1160521249 18:79509385-79509407 CCTTCACTGTAGGAGGAGCTGGG + Intronic
1160767191 19:813850-813872 GCTTCTCTGCAGGTGGGGCCTGG + Exonic
1161170063 19:2808095-2808117 CCCTCTCAGCAGAGGTGGCTTGG - Intronic
1161709452 19:5839639-5839661 ACTGCCCTGCAGGAGTGGGTGGG - Exonic
1162035001 19:7933914-7933936 CGTTCTCTTCCGGAGTCGCTGGG + Exonic
1162175133 19:8824654-8824676 CCTTCTCCGCAGGGCTTGCTGGG + Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1163281138 19:16318521-16318543 CTCTCTGTGCAGGAGAGGCTTGG - Intergenic
1163855795 19:19701141-19701163 CCCTATCTGCAGGACTTGCTCGG + Intergenic
1163888938 19:19993801-19993823 CCCTATCTGCAGGACTTGCTCGG + Intergenic
1163968891 19:20773540-20773562 CCCTATCTGCAGGACTTGCTTGG + Intronic
1164913286 19:32029307-32029329 TCTGCTCTACAGGAGTGGCTTGG - Intergenic
1167006828 19:46781733-46781755 CCTTCTCTGCACAAGTGGCTGGG - Intronic
1168254549 19:55158274-55158296 CCTTGTCTGAGGGAGGGGCTGGG - Intronic
1168703473 19:58455033-58455055 CTGGCTCTGCAGGAGGGGCTGGG - Intronic
926058038 2:9787814-9787836 CCTTCTGTGCTGTAGTTGCTGGG + Intergenic
926092203 2:10058385-10058407 CCATCTCTCCAGGGGTGGCCGGG - Exonic
928904107 2:36353479-36353501 CCTCCTCTGCAAGAGTGGGAGGG + Intergenic
929128113 2:38539180-38539202 CCATCTCTCCAGAAGTGCCTGGG - Intergenic
930181408 2:48362451-48362473 CCTTAGCTGCCTGAGTGGCTGGG - Intronic
930352071 2:50269232-50269254 CCTTCTCGGCTGGAGTGCCAGGG - Intronic
931884289 2:66599126-66599148 ACTTAGCTGCAGGAGAGGCTGGG - Intergenic
931953917 2:67397209-67397231 CCTGCTCTGGAGGAGTGTCTAGG - Intergenic
932362559 2:71121171-71121193 ACTTCTCTGCAAGGGAGGCTGGG - Intronic
932618808 2:73253701-73253723 CCATCTAACCAGGAGTGGCTGGG - Intergenic
933197894 2:79413160-79413182 GCTTTTTTGCAGGGGTGGCTGGG + Intronic
933246426 2:79979817-79979839 CTTTCTCTGCATTAGTTGCTAGG - Intronic
934991781 2:98926808-98926830 CCTTCGCTGCAGGCGTGGGAAGG - Intronic
936398790 2:112150210-112150232 CCATCTCTGAAGGAGGGGCTGGG + Intronic
937929882 2:127195858-127195880 CCTTCTTTGCAGGGCTTGCTCGG + Intronic
938067126 2:128287282-128287304 CCTTCTCTGGGGGAGTGCCCTGG - Intronic
938092594 2:128443139-128443161 CCTTCTCTGCTGAGGTGGCCTGG + Intergenic
939471804 2:142631632-142631654 CCCTCTCTGCAGCAGTAGATTGG - Intergenic
939471889 2:142633125-142633147 CCCTCTCTGCAGCAGTAGATTGG + Intergenic
939600932 2:144189319-144189341 CCTGCCCTGCAGGAGGGCCTTGG - Intronic
939858966 2:147394766-147394788 TCTTTTCAACAGGAGTGGCTGGG - Intergenic
941017268 2:160371654-160371676 CCTTTCCTGCACGAGTGGTTTGG + Intronic
942547977 2:177084324-177084346 CCCTCTCTGCAGAAGTGGGCTGG - Intergenic
943093889 2:183405332-183405354 CCCTTTCTGCAGGAGTTGTTGGG + Intergenic
944666970 2:201966949-201966971 CCTACTCAGCAGGAGCGCCTAGG - Intergenic
944910608 2:204306820-204306842 TCTTCTCTGCAGTAGTTGCAGGG - Intergenic
946864072 2:224027147-224027169 ACTTCTCTGCATGAAGGGCTTGG + Intronic
947520507 2:230842416-230842438 CCTTCTCTTCATGAATGACTGGG - Intergenic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
948452364 2:238084072-238084094 CCATCTTTGCAGGTGTGGATAGG - Intronic
948601588 2:239110811-239110833 TCTCCCCTGCAGGGGTGGCTGGG + Intronic
1169385459 20:5145385-5145407 CGTTCTCTGCAGGTGAGTCTGGG + Intronic
1170092487 20:12605602-12605624 CCTTATATGAAGGAGAGGCTGGG - Intergenic
1170567605 20:17615782-17615804 CCTTCTGGGCAGCAGTGGGTGGG - Intronic
1171360099 20:24581519-24581541 CTATCTCTGCAGGAGATGCTCGG - Intronic
1171361689 20:24590535-24590557 CCTGTGCTGCAGGAGTGGCTGGG + Intronic
1172008760 20:31834341-31834363 CCTTATCTGCTGGAGTGGGGAGG - Exonic
1172660139 20:36562413-36562435 CCTCAGCTGCAGGAGTAGCTGGG - Intergenic
1172692327 20:36798544-36798566 CCTTCTCTGGAGGATTGCCTTGG + Intronic
1173161833 20:40658606-40658628 CCCACTCTGCAGGAGTGGAGGGG - Intergenic
1173186590 20:40844895-40844917 CCTTCTCTGCAGAAGTTTCTGGG - Intergenic
1175144275 20:56883972-56883994 CCTTCTCTGGAGGTCTGGATCGG - Intergenic
1175902591 20:62366012-62366034 CCTTCCCGGAAGGAGAGGCTGGG - Intronic
1175969643 20:62677955-62677977 CCAAATCTGCAGGTGTGGCTAGG - Intronic
1176096990 20:63348879-63348901 CATTCCATGCAGGAGAGGCTGGG - Intronic
1176232517 20:64039459-64039481 CCCCCTCTGCAGGACTGGCCAGG + Intronic
1177288151 21:19077781-19077803 CATCCTCTGCTGGAGTGACTGGG - Intergenic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1179288096 21:39995334-39995356 CCATCTCTGCAGCCGTTGCTGGG - Intergenic
1179288307 21:39996840-39996862 CCTTCTCTGCAGGAGCACCGTGG - Intergenic
1179559890 21:42208939-42208961 CCTCCTCTCCAGGAGGGCCTGGG - Intronic
1181324289 22:22032783-22032805 CCTTCACTGCACAGGTGGCTAGG + Intergenic
1181756573 22:25028700-25028722 CCTTCTCTTCAGGCGAGGCCTGG - Exonic
1182119722 22:27778997-27779019 CCATCTCTGCAGGGGTGGGTAGG - Intronic
1182347228 22:29674754-29674776 CCTCCTCTGCAGGGGTGGGGTGG + Intronic
1182978721 22:34647898-34647920 CCATCTCTGCAGCAGTAGATGGG - Intergenic
1183186553 22:36294847-36294869 ACTGCTCTGCAGGACTGGTTTGG + Intronic
1183716231 22:39535130-39535152 CCTGGCCTGGAGGAGTGGCTGGG + Intergenic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
1185251743 22:49805600-49805622 CCTCCTCTGCAGGCTGGGCTGGG + Intronic
950742364 3:15061858-15061880 CCTTCTCAGACGGGGTGGCTGGG - Intronic
951195950 3:19823474-19823496 AGTCCTCTGCAGCAGTGGCTAGG + Intergenic
953770925 3:45778129-45778151 CCTTCTCAGCAGGAGCACCTGGG - Intronic
954599773 3:51858714-51858736 ACTTCTCAGAAGGGGTGGCTGGG - Intergenic
955504009 3:59613260-59613282 CCTTCTCTGCAGAAATCTCTAGG - Intergenic
955754077 3:62210286-62210308 ATTTCTCTGCAGCAGTGGTTTGG + Intronic
956355616 3:68389607-68389629 CCTTCTCTGCTGTTGTTGCTGGG - Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
956474937 3:69609934-69609956 CCCTTTCAGCTGGAGTGGCTGGG - Intergenic
958733187 3:97980005-97980027 CCTTCTCTGCATCTGTGTCTAGG + Intergenic
960784925 3:121362360-121362382 CCTTCTCTTCAAGGGTGGCAAGG + Intronic
961008898 3:123423305-123423327 CCTTCTCCGCAGGGGTGGGGCGG - Intronic
963479657 3:145855001-145855023 CTGTCTCTGTGGGAGTGGCTTGG + Intergenic
965639426 3:170816935-170816957 CTTTATCTGAAGGAGTGTCTTGG - Intronic
966955175 3:184869470-184869492 CCTTCTCTGCAGGATTATCAGGG + Exonic
967144134 3:186591693-186591715 CTTTCTCTGCTGGGGTGCCTGGG + Intronic
967742639 3:193020228-193020250 CCTTCTCTCCATGAGAAGCTGGG - Intergenic
968494897 4:910141-910163 TCTTCTCTGCAGCTGTGCCTGGG - Intronic
969388592 4:6873916-6873938 CCTACTCAGCAGAAGTGGCTGGG + Intronic
969553389 4:7888341-7888363 CCTGCTCTGAATGTGTGGCTAGG + Intronic
973673535 4:53241081-53241103 CCTCTTCTGCAGGAGTTGTTGGG - Intronic
974644282 4:64671991-64672013 CCAGGTCTGCAGCAGTGGCTTGG + Intergenic
974650598 4:64748989-64749011 CCCCTTCTGCAGGAGTGGCTGGG + Intergenic
976619848 4:87116456-87116478 CCTTCTCAGCAGGAGAGAGTTGG - Intronic
977312571 4:95405238-95405260 CCAGCTCTGCAGTAGTGTCTAGG - Intronic
977445279 4:97123974-97123996 CATGCACTGCAGGAGGGGCTTGG - Intergenic
978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG + Intergenic
978745986 4:112194890-112194912 CTGTCTCAGCAGGAGTGGTTGGG + Exonic
981322747 4:143411546-143411568 CCTGCTCTGCAGGATTGGCAAGG + Intronic
982262786 4:153509608-153509630 CCTCCTCCTCAGGAGTAGCTGGG - Intronic
985666631 5:1184536-1184558 CCTCCACTGCAGGGGAGGCTCGG - Intergenic
987741976 5:21920948-21920970 CCTCCTCTGCAGCAGATGCTTGG + Intronic
988542400 5:32122364-32122386 ACTGCTCTGCAGTATTGGCTAGG + Intergenic
990919405 5:60945679-60945701 GCTCCTCTACAGGCGTGGCTGGG - Intronic
991197954 5:63958739-63958761 GTTTCTCGGCAGGAGTGGCAAGG + Intergenic
991503714 5:67303108-67303130 CCTTCTCTCCTTGAGTGTCTTGG - Intergenic
992147082 5:73861166-73861188 CCAGCTCTGCATGAGTGACTCGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995752626 5:115470160-115470182 CCTTGTCTGCACCAGTGTCTTGG + Intergenic
998169497 5:139864154-139864176 CCTGCTCTGCAGGATGGGATGGG + Intronic
999282054 5:150372464-150372486 CCCTCACAGCAGGACTGGCTGGG - Intronic
1000975886 5:167764002-167764024 CACTATCAGCAGGAGTGGCTTGG - Intronic
1001416974 5:171552163-171552185 CCTTCCCTGCAGGAGTGAATGGG - Intergenic
1001453045 5:171840835-171840857 CCTTTCTTGAAGGAGTGGCTTGG - Intergenic
1001547662 5:172580422-172580444 CCTGCTCTCCAGGAGCAGCTGGG - Intergenic
1002868795 6:1147442-1147464 ACTCCACTGCTGGAGTGGCTGGG - Intergenic
1002921318 6:1575300-1575322 CCTCCTCTGTAGGTGTGGGTAGG + Intergenic
1003995021 6:11531515-11531537 ACTTCCCTGCAAGGGTGGCTGGG + Intergenic
1004173176 6:13315091-13315113 CCCTGTCTGCAGTAGAGGCTGGG - Intronic
1004917043 6:20341835-20341857 CCCTCCCTGCAGGTGTGGTTTGG - Intergenic
1005652182 6:27894582-27894604 CGTTATCTGCAGGAGTGCATCGG + Intergenic
1006154372 6:32006349-32006371 GCTTGTCTGCAGGAGGAGCTGGG - Intergenic
1007226206 6:40316620-40316642 CCTTTTCTTGAGGAGAGGCTGGG + Intergenic
1007722616 6:43894197-43894219 TATGCTCTGCAGGAGTGGCAGGG + Intergenic
1010497697 6:76555307-76555329 CTTTCTCTGCAGGATTAGGTAGG - Intergenic
1010846158 6:80711117-80711139 TCTTCTCTGCTGTAGTGACTGGG - Intergenic
1013079655 6:106801229-106801251 CCATCTCTTCAGTGGTGGCTTGG - Intergenic
1013110854 6:107063873-107063895 CCTTCTCAGCAGGTGTGCCTTGG - Intergenic
1014865366 6:126522099-126522121 CCCTCTCAGCATCAGTGGCTTGG - Intergenic
1017238992 6:152146792-152146814 CCTTCACTGCATGTGTGGCTTGG + Intronic
1018613364 6:165663103-165663125 CCCTCCCTGCAGGCGTGGCGTGG + Intronic
1021307064 7:19045478-19045500 CATTCTCTGCTGGAGTGGGTGGG - Intronic
1022477578 7:30721884-30721906 CCATCTCTGCAGTTGGGGCTGGG + Intronic
1022493311 7:30837258-30837280 CCTCTTCTGCAGGGGTGTCTGGG + Intronic
1022647438 7:32244424-32244446 GCTTCAGTGCAGGACTGGCTAGG - Intronic
1025196833 7:56940530-56940552 CCGACTCTGCAGGAGGGGCGAGG - Intergenic
1025675115 7:63636407-63636429 CCGACTCTGCAGGAGGGGCGAGG + Intergenic
1026239208 7:68557365-68557387 CCTTCTCTACAGGAAGGGGTGGG + Intergenic
1026871717 7:73856879-73856901 CCTTGCCTTCAGAAGTGGCTTGG + Intergenic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1028577402 7:92367219-92367241 CTTTCTCTGCAGCCTTGGCTTGG - Intronic
1032195951 7:129788672-129788694 GTTTCTCTGCAGCAGAGGCTGGG - Intergenic
1033135928 7:138784073-138784095 ACTTTTCTGCAAGAGTGGATTGG - Intronic
1034730304 7:153381453-153381475 CCTTGTCTTCAGGAGAGTCTAGG - Intergenic
1034757132 7:153633068-153633090 CCTTTTCTGCAAGAGTGGAAAGG - Intergenic
1036205283 8:6801010-6801032 GCTTGGCTGCAGGAGCGGCTGGG - Intergenic
1036702118 8:11019705-11019727 CTGTGTCTGCAGGTGTGGCTGGG - Intronic
1036792421 8:11730254-11730276 TCTTCGCTGCAGGAGTGACAGGG + Intronic
1038493744 8:27987620-27987642 CCTTCTCTGCAGCTGTTGCAGGG - Exonic
1038723616 8:30059837-30059859 CCTTCAATGAAGGAGAGGCTGGG - Intergenic
1039503337 8:38033638-38033660 CATTCCCAGCAGGAGTGACTGGG - Intronic
1039524567 8:38202655-38202677 CCTTAACTGCTTGAGTGGCTGGG + Intronic
1040600463 8:48878774-48878796 CAGTCTCAGCAGGAGAGGCTAGG + Intergenic
1042403106 8:68372388-68372410 TCTTCTCAGCAGGAGGGACTGGG - Intronic
1043087267 8:75849907-75849929 TCATCTCTGCAGCTGTGGCTGGG - Intergenic
1043475744 8:80604188-80604210 CCCTCTCTGCAAGAGATGCTGGG - Intergenic
1045650927 8:104341102-104341124 CCTTCTCTGGAGGAAAGGCCAGG - Intronic
1047367467 8:124224654-124224676 CCTTAGCTGCATGAGTAGCTGGG - Intergenic
1047755369 8:127913967-127913989 CCTGCTTTTCAGTAGTGGCTGGG + Intergenic
1048379103 8:133848169-133848191 TCTTAGCTGCAGGAGAGGCTGGG + Intergenic
1048541809 8:135348867-135348889 ACTGCTCTGGAGGAGTGGGTTGG - Intergenic
1049235899 8:141512174-141512196 CCTTGGCTGCAAGAGAGGCTGGG - Intergenic
1049426363 8:142539665-142539687 CCTGCTCAGCAGGAGTGCCAGGG - Intronic
1053323147 9:37118573-37118595 CCTTAACCTCAGGAGTGGCTAGG + Intergenic
1053483701 9:38436076-38436098 CCTTCTAGGCCAGAGTGGCTTGG - Intergenic
1056595936 9:88007563-88007585 CCTTCCCAGCAGGAGGGGCTGGG - Intergenic
1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG + Intergenic
1057846731 9:98531617-98531639 CCCACTCTGCAGGGGTGGGTAGG + Intronic
1058103125 9:100938321-100938343 CCTCCTCTCCAGGAAAGGCTCGG - Intergenic
1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG + Intronic
1059153159 9:111967130-111967152 TCTTCTCTGCAGGATCTGCTGGG - Intergenic
1059438240 9:114289062-114289084 CCCTCCCTGCAGGAGGGTCTGGG + Intronic
1059441064 9:114307150-114307172 CCTCCTCTGCACAAGCGGCTGGG + Intronic
1060108662 9:120891100-120891122 CCACCCCTGCAGGAGAGGCTTGG - Intronic
1060620737 9:125063291-125063313 CCTTCACTTCCTGAGTGGCTGGG - Intronic
1061087194 9:128405983-128406005 CCTTCTCAGCAGCAGGAGCTGGG + Intergenic
1061620572 9:131808877-131808899 CCGTCCCAGCAGGCGTGGCTGGG - Intergenic
1062061530 9:134498966-134498988 CCTACTCAGCAGAAATGGCTGGG + Intergenic
1186366939 X:8905418-8905440 ACTTCTCTGTAGGAGAGGCTTGG - Intergenic
1186668587 X:11745366-11745388 CCTTTTCTGCAGCAGTGTCTGGG + Intergenic
1187165465 X:16800536-16800558 CCTCCTCTCCAGGCCTGGCTCGG - Intronic
1189371265 X:40431434-40431456 CAGTCACTGCTGGAGTGGCTGGG - Intergenic
1193094153 X:77528214-77528236 CTCTGTCTGCAGGAGTGGGTCGG - Intronic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1194756043 X:97741204-97741226 CCCTCTCTGGAGAAGGGGCTGGG + Intergenic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1195279633 X:103318491-103318513 ACCTCTCTGAAGGAGAGGCTTGG + Intergenic
1195544662 X:106101069-106101091 CCCCCTCTGCAGGAGTCACTGGG + Intergenic
1198466220 X:136907063-136907085 GCTTATCTCCAGGACTGGCTTGG + Intergenic
1200044569 X:153394322-153394344 CCCTCGCTGCAGGAGAAGCTGGG + Intergenic
1200745316 Y:6899096-6899118 CCTTGTCTGAATGGGTGGCTGGG + Intergenic
1202251480 Y:22877974-22877996 CCTGTTTTGCAGGAATGGCTTGG + Intergenic
1202404468 Y:24511723-24511745 CCTGTTTTGCAGGAATGGCTTGG + Intergenic
1202466311 Y:25158359-25158381 CCTGTTTTGCAGGAATGGCTTGG - Intergenic