ID: 1128513597

View in Genome Browser
Species Human (GRCh38)
Location 15:68328177-68328199
Sequence CACTGCGCTTGCAGTCTCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128513593_1128513597 -2 Left 1128513593 15:68328156-68328178 CCAGGCAGGTGGCATCCCTGCCA 0: 1
1: 0
2: 0
3: 28
4: 276
Right 1128513597 15:68328177-68328199 CACTGCGCTTGCAGTCTCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128513597 Original CRISPR CACTGCGCTTGCAGTCTCTG TGG Exonic
900136365 1:1118851-1118873 TACTGCACCTGAAGTCTCTGGGG - Intergenic
901160251 1:7171891-7171913 CACTCCTCATGCAGTTTCTGAGG + Intronic
903346233 1:22685886-22685908 CACTGGGTTTGAAGTGTCTGCGG - Intergenic
905910039 1:41647448-41647470 TTCTGCTCTTGCAGTCACTGTGG - Intronic
906118137 1:43368780-43368802 CACGGGGCTTGCAGTCTATCTGG + Intergenic
910649455 1:89549966-89549988 CACTGAGTTTGCAGTACCTGTGG - Intronic
913241091 1:116830090-116830112 CACTGTGCTCTCTGTCTCTGAGG - Intergenic
915752686 1:158226966-158226988 CTCTGCAATTGCAGTCTTTGTGG - Intergenic
915970543 1:160352085-160352107 CACTGCGCTTTCAGCCCCTGGGG - Exonic
918209839 1:182340820-182340842 CACTGTGATTGCTATCTCTGTGG - Intergenic
919230359 1:194765189-194765211 CACTGAGCTTGTAAACTCTGAGG - Intergenic
919944592 1:202310042-202310064 CACTGTGCTGGCAGTCTCCTAGG - Intronic
920244368 1:204576659-204576681 CACTGTCCTTACAGTCTCTAAGG - Intergenic
920743061 1:208599560-208599582 AACTGAGCTTCCAGTCACTGAGG + Intergenic
1064008479 10:11716181-11716203 CACTGTGCTGTCATTCTCTGTGG + Intergenic
1065845463 10:29739265-29739287 TACTGTGCTTGGAGTGTCTGTGG - Intergenic
1066323374 10:34327958-34327980 CTCTGGACTTGCTGTCTCTGTGG - Intronic
1069280824 10:66651628-66651650 CACTGCGCTGGAATTCTCTCAGG - Intronic
1070522650 10:77267822-77267844 CACTGAGCTTTCAGTCCCTGGGG + Intronic
1070788813 10:79177609-79177631 CACAGGGCCTGCAGTCCCTGAGG + Intronic
1073812510 10:107165482-107165504 CAATGAGTTTGCAGTCTCTTAGG - Intergenic
1074244589 10:111676234-111676256 CACTGAGCTTGTAAACTCTGAGG + Intergenic
1077474867 11:2781555-2781577 CACAGGGCTGGCAGTCTGTGTGG + Intronic
1077844780 11:6012981-6013003 CTCTGCCCTTGCAGGCTCAGAGG - Intergenic
1078170818 11:8927676-8927698 CACTGCCCTTGCAGTCAACGAGG + Intronic
1079350031 11:19684658-19684680 CACTGGGCTTGCAGTGTGGGGGG - Intronic
1084413910 11:69019498-69019520 CACTGCCCTTGCCTTCTCTGTGG + Intergenic
1084786181 11:71442987-71443009 CACTGAGCTTTCTGCCTCTGTGG + Intronic
1086101700 11:83106904-83106926 TGCTGCCCTTGCAGACTCTGAGG - Intergenic
1087211152 11:95447223-95447245 CACTGCCCCTGCAGGCTCCGAGG - Intergenic
1088332469 11:108667981-108668003 CACTGTGCTACCAGACTCTGGGG - Intronic
1091974244 12:4811662-4811684 CACTGAGCTAACAGTCTCTTAGG + Exonic
1093266727 12:17012501-17012523 CACTGCTCTTGCTGTATCTCAGG + Intergenic
1098658248 12:73059976-73059998 CATTGAGATTGCATTCTCTGAGG + Intergenic
1099085514 12:78241819-78241841 CACTGTGCTTGAAGACTTTGAGG + Intergenic
1101065046 12:101012225-101012247 CACAGAGCTTGCAGTCTGTAGGG + Intronic
1101146953 12:101849870-101849892 CACTGCGGTCTCAGCCTCTGGGG - Intergenic
1104920461 12:132287881-132287903 CTCTGAGCTGGGAGTCTCTGGGG + Intronic
1105306642 13:19173699-19173721 CACTGTCCATGCAGGCTCTGGGG + Intergenic
1107191084 13:37586979-37587001 GAATGGGCTTGCAGTCTCAGTGG - Intronic
1108452440 13:50580665-50580687 CACTCTGCTTCCAGTCTCTATGG + Intronic
1109494796 13:63155648-63155670 GAATGTGTTTGCAGTCTCTGTGG + Intergenic
1113211924 13:107993468-107993490 CACTGTGGTCACAGTCTCTGTGG - Intergenic
1122060869 14:99135983-99136005 CATGGTGCTTGCAGTCTCTTGGG + Intergenic
1122231510 14:100308386-100308408 CACTGAGCTGTCAGTCCCTGGGG + Intergenic
1122273143 14:100577404-100577426 CACTCTGCTTGCAGCCTCAGTGG + Intronic
1123135397 14:106022938-106022960 CACAGCGTTTTCACTCTCTGTGG + Intergenic
1123492866 15:20796625-20796647 CACTGCTCCTGCTGTCTCAGAGG - Intergenic
1123952916 15:25300722-25300744 CTCTGGGCTTGCTGTATCTGTGG - Intergenic
1128442215 15:67721523-67721545 CACTGCACTAGAAGTCTATGAGG + Intronic
1128513597 15:68328177-68328199 CACTGCGCTTGCAGTCTCTGTGG + Exonic
1129624203 15:77179629-77179651 CACTGTGCTTGCTTTCTCTCTGG + Exonic
1129678953 15:77647152-77647174 CACTGCCCTTCCAGCCTCAGTGG - Intronic
1131405025 15:92157275-92157297 AACTGCTCTTGCAGGCTTTGGGG + Intronic
1132187293 15:99812250-99812272 CACTGCAGTCTCAGTCTCTGGGG + Intergenic
1202957698 15_KI270727v1_random:92937-92959 CACTGCTCCTGCTGTCTCAGAGG - Intergenic
1132533089 16:463264-463286 CACTGCACCTGCTGACTCTGAGG - Intronic
1132859019 16:2060912-2060934 CACGGTTCTGGCAGTCTCTGCGG - Intronic
1133127667 16:3656841-3656863 CACTGCCCTCCCAGTCCCTGGGG + Intronic
1133414981 16:5599392-5599414 CATTGGGCTTGGAGTCACTGGGG + Intergenic
1133415875 16:5606608-5606630 CAAAGCGCTTGCAGTCTGTGAGG + Intergenic
1134032593 16:11004432-11004454 CAGTCTGGTTGCAGTCTCTGTGG + Intronic
1136105286 16:28025834-28025856 CACTTCTGTTGCAGTCCCTGGGG - Intronic
1136300118 16:29328775-29328797 TAGTGGGCCTGCAGTCTCTGTGG + Intergenic
1139437019 16:66942165-66942187 AACTGCGCTTGGAGGGTCTGGGG - Exonic
1139459999 16:67114143-67114165 CAGTGAGCCTTCAGTCTCTGTGG - Intronic
1140615433 16:76657305-76657327 GACCGCGCTTGCTGCCTCTGTGG + Intergenic
1143134148 17:4701592-4701614 TACTGAGCTTGCAGTACCTGCGG + Intronic
1143216962 17:5232452-5232474 CAATGGGCCTGCAGCCTCTGTGG - Intronic
1145982105 17:29018955-29018977 CACTGCGCTTCCACTTCCTGTGG - Intronic
1146486259 17:33245448-33245470 CACTGTGCTGGCTGTCTATGAGG + Intronic
1146918400 17:36692848-36692870 CACAGCGCTTGCATTCTCATGGG - Intergenic
1146922641 17:36723494-36723516 CCCTGCTCCTGCAGACTCTGAGG - Intergenic
1147051269 17:37796697-37796719 CACAGAGCTTGCAGTCCCTGGGG - Intergenic
1148856291 17:50580864-50580886 CCCTGTGCTTGCAGGCACTGCGG + Intronic
1148945822 17:51260758-51260780 CGCTGCGATTGCAGTCGCGGCGG + Exonic
1150575617 17:66428138-66428160 CACTTCGATTCCACTCTCTGTGG + Intronic
1150594254 17:66590305-66590327 CACAGCCCTTGCTGTATCTGAGG + Intronic
1151547239 17:74800645-74800667 CACTGGACTTGGAGACTCTGGGG + Intronic
1152717716 17:81907841-81907863 GCGTGCGCTTGCATTCTCTGGGG + Exonic
1152928327 17:83098042-83098064 CACTGCTCTTGCAGCACCTGGGG - Intergenic
1154450406 18:14471162-14471184 CACTGCTCCTGCTGTCTCAGAGG - Intergenic
1157338534 18:46758081-46758103 CCCAGCGCTTGGAGCCTCTGCGG - Intronic
1157766567 18:50301999-50302021 CACTGCACCTGTCGTCTCTGGGG + Intergenic
1160199651 18:76786051-76786073 CACTGCCCTTACTGTCCCTGTGG - Intergenic
1165423713 19:35734310-35734332 CACAGGCCTGGCAGTCTCTGTGG - Intronic
1165485009 19:36090228-36090250 CACTGAGCTTGCAGTGTGTGGGG + Intronic
1166287146 19:41838245-41838267 GACTCCCCTTGCAGTCCCTGAGG + Exonic
1167050268 19:47073740-47073762 CACTCTGCTTTCCGTCTCTGCGG + Intronic
1168374741 19:55867284-55867306 CACTTGGCTTACGGTCTCTGGGG - Intronic
926350760 2:11992086-11992108 CTCAACCCTTGCAGTCTCTGCGG - Intergenic
926953765 2:18271899-18271921 CCCTGCCCTTGCAGGCTCAGAGG - Intronic
929505291 2:42523502-42523524 CTCTGCTCTTGAAGTCACTGAGG - Intronic
929769166 2:44877654-44877676 CCCTGGGGTTGCAGTCTTTGTGG - Intergenic
930352572 2:50276290-50276312 CATTGTGCTTGCTGTCTCTTTGG + Intronic
931890721 2:66668802-66668824 CACTGTGCTTTCAATCACTGTGG - Intergenic
932306608 2:70708094-70708116 CACTACCTTTGCAGTCTCTCTGG + Intronic
933730492 2:85452508-85452530 GAGTGGGCTTGCAGTGTCTGAGG - Intergenic
934937824 2:98477988-98478010 CAGTGCGAGTGCAGTCCCTGCGG + Intronic
935675412 2:105590875-105590897 CACAGAGCTTGCTGTCTCTCTGG + Intergenic
937710671 2:124977084-124977106 AACTGGGCTTGCAGTGGCTGAGG + Intergenic
939933440 2:148259260-148259282 AACTACACTTCCAGTCTCTGAGG - Intronic
942146461 2:173031957-173031979 CACTGCTCTTGTGGTCACTGTGG - Intronic
944315144 2:198276714-198276736 CACTGCTTTTCCAGCCTCTGAGG + Intronic
948897328 2:240933554-240933576 CTCTGCCCATGCAGTCTCAGGGG + Intronic
1174108604 20:48181647-48181669 CACTGCTCCTGCAGTTACTGAGG + Intergenic
1175369078 20:58474913-58474935 GACTCCGCTTTCTGTCTCTGTGG + Intronic
1175882714 20:62270134-62270156 CCCTGCGCATGCAGTGCCTGTGG + Intronic
1176445781 21:6819209-6819231 CACTGCTCCTGCTGTCTCAGAGG + Intergenic
1176823949 21:13684242-13684264 CACTGCTCCTGCTGTCTCAGAGG + Intergenic
1180959209 22:19755108-19755130 CAGTGGGTTTGCAGCCTCTGGGG - Intergenic
1181572089 22:23773133-23773155 CAGCGAGCTTGCAGTCCCTGGGG + Intronic
1182023033 22:27097163-27097185 CATTGGGCTTGCATTCTTTGTGG - Intergenic
1182489900 22:30664608-30664630 CACTGTGCTGGCAGTCACTGAGG + Intronic
1182639821 22:31758050-31758072 CACTGCTCCTGGACTCTCTGAGG + Intronic
1184479279 22:44737549-44737571 CACTGGGTTTACATTCTCTGTGG - Exonic
1184993913 22:48188637-48188659 CACACCACTTGCAGTTTCTGTGG - Intergenic
950540828 3:13611460-13611482 CATTCCGCTTTCTGTCTCTGTGG + Intronic
950832844 3:15892268-15892290 AACTGGTCCTGCAGTCTCTGAGG - Intergenic
951187795 3:19734601-19734623 CATTGCCCTTGCAGGCGCTGTGG + Intergenic
957704611 3:83763757-83763779 AACTGGGCTTGCAGTCTATCTGG + Intergenic
957754258 3:84466717-84466739 CACTGAGTTTGCAAACTCTGAGG + Intergenic
963680322 3:148366773-148366795 CACTGCACTTTATGTCTCTGTGG + Intergenic
965728593 3:171746079-171746101 CACTGCGCTTGAATTCTCACTGG + Intronic
966278541 3:178204403-178204425 CACTTCTCCTACAGTCTCTGAGG + Intergenic
967380778 3:188855324-188855346 TACTGCATTTGCAGCCTCTGCGG - Intronic
968615337 4:1575189-1575211 AGCTGTGCTTGCAGTCCCTGAGG + Intergenic
968627096 4:1630713-1630735 CCCTCCGCTTGTTGTCTCTGTGG - Intronic
973590919 4:52440749-52440771 CACTGTGCGTGTAGTCTCTCAGG + Intergenic
975530280 4:75393086-75393108 CACTGCGCATGCAGTCTTTCTGG + Intergenic
977510269 4:97953402-97953424 AGCTGTGGTTGCAGTCTCTGTGG - Intronic
977949893 4:102958632-102958654 CACTGCGCCTGGCCTCTCTGGGG - Intronic
978354230 4:107853741-107853763 CACAGAGCTTGCAGTCTCACTGG + Intronic
981777991 4:148392521-148392543 CACGGCACTTGCACTCACTGAGG + Intronic
987196438 5:15531485-15531507 CACTCAGCTTGCTGTCTCTCAGG - Intronic
988442604 5:31249800-31249822 CAATGGGCCAGCAGTCTCTGTGG + Intronic
998680497 5:144461369-144461391 CACGGTGCTTTCATTCTCTGAGG - Intronic
999060758 5:148632448-148632470 CACTGACCCTGCAGTCCCTGGGG - Intronic
1002065735 5:176650812-176650834 CCCTGGGCGTGCAGTCTCAGAGG - Intronic
1003285702 6:4732257-4732279 CACTACATTTGCAATCTCTGGGG - Intronic
1006112023 6:31753211-31753233 AAGTGTGCTTGCAGTCCCTGGGG - Intronic
1006167810 6:32075508-32075530 CACTGCGAGGGCAGTGTCTGAGG - Intronic
1008510423 6:52270901-52270923 CTCTGCGCATGCTGTCACTGGGG + Intronic
1011449023 6:87473199-87473221 CGCTGCGGCTGCAGTCTCCGCGG + Intronic
1012443737 6:99287771-99287793 CCCTGCCTTTGCTGTCTCTGTGG - Intronic
1012528958 6:100211564-100211586 CACTCTGCTTGCATTCTCCGTGG - Intergenic
1012752972 6:103185866-103185888 CACTGAGCTTGCTGAATCTGTGG - Intergenic
1014209004 6:118688351-118688373 CACTGAGCTTGCATTCTGTTTGG - Intronic
1018921850 6:168180990-168181012 CTCTGCGCTAGCAGTCTGCGGGG + Intergenic
1019922110 7:4169540-4169562 CAGTGAGCTCGCCGTCTCTGAGG + Intronic
1020697276 7:11429072-11429094 CACTGAGCTTGCAGTCTGAGGGG + Exonic
1026808880 7:73445580-73445602 CACTGCGCCTGATCTCTCTGAGG - Intronic
1026826702 7:73587003-73587025 CCCTGCGCTAGCTGTCACTGAGG - Intergenic
1028567142 7:92246012-92246034 CACTGGACCTGCAGTCTCTCAGG + Exonic
1037269440 8:17110451-17110473 CACTCTGCTTTCTGTCTCTGTGG + Intronic
1037784340 8:21893545-21893567 CAGGGCACTTGCAGCCTCTGAGG + Intergenic
1038613744 8:29074806-29074828 CACTGCGCTTTCATTCTCTTAGG - Intronic
1039729273 8:40256809-40256831 CACCACTCTTGCAGTCTCTCTGG - Intergenic
1043844913 8:85152803-85152825 CACTGCGCTTGAATTCTCGCCGG + Intergenic
1045584516 8:103517781-103517803 CACAGTGCTTTCAGTCTCTGTGG + Intronic
1045731611 8:105248271-105248293 CACTGCGCCTGGCCTCTCTGAGG - Intronic
1049012908 8:139899509-139899531 CACTGGTCTTGCTGTCTCAGGGG + Intronic
1049602021 8:143512437-143512459 CAGTCCTCTTGCAGTTTCTGAGG + Intronic
1049831880 8:144705871-144705893 CCCTCCTCTTGCAGCCTCTGTGG + Intergenic
1051312863 9:15795182-15795204 GAGTGTGCTTGCATTCTCTGGGG + Intronic
1056767912 9:89456060-89456082 CGATGCTCTTGCAGTCCCTGGGG - Intronic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1061788027 9:133042490-133042512 CAATGAACCTGCAGTCTCTGGGG - Intronic
1203523412 Un_GL000213v1:65316-65338 CACTGCTCCTGCTGTCTCAGAGG - Intergenic
1187242909 X:17529948-17529970 CACTTCGCTTGGAGACTCTCTGG + Intronic
1189617320 X:42797006-42797028 CACTGCCATGGCAGTCCCTGAGG - Intergenic
1190029668 X:46959785-46959807 CTCTGCCCCTTCAGTCTCTGTGG - Intronic
1190303014 X:49067380-49067402 CACTGCTCTTGCAGACTGGGGGG - Exonic
1195330704 X:103796949-103796971 CACTGCACCCGCAGCCTCTGGGG - Intergenic
1195981576 X:110583917-110583939 CACTGGACTGGCAGTCTCTAGGG + Intergenic
1197046245 X:122002150-122002172 GACTAGGATTGCAGTCTCTGAGG + Intergenic
1200360789 X:155604227-155604249 CACTGCAGTGGCAGTCTCAGAGG - Intronic
1201280983 Y:12341787-12341809 CACTGCACCTGCAGTCTCCTGGG + Intergenic